ID: 1067724896

View in Genome Browser
Species Human (GRCh38)
Location 10:48762596-48762618
Sequence CTGAGGTGCCACAGCTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067724896_1067724900 -6 Left 1067724896 10:48762596-48762618 CCTCTTTAGCTGTGGCACCTCAG 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1067724900 10:48762613-48762635 CCTCAGCAAGGCTGGCTCCCTGG No data
1067724896_1067724905 13 Left 1067724896 10:48762596-48762618 CCTCTTTAGCTGTGGCACCTCAG 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG No data
1067724896_1067724907 26 Left 1067724896 10:48762596-48762618 CCTCTTTAGCTGTGGCACCTCAG 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1067724907 10:48762645-48762667 CCTAAGCTGGCTTAGCTGAGTGG No data
1067724896_1067724901 0 Left 1067724896 10:48762596-48762618 CCTCTTTAGCTGTGGCACCTCAG 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1067724901 10:48762619-48762641 CAAGGCTGGCTCCCTGGCAAAGG No data
1067724896_1067724902 1 Left 1067724896 10:48762596-48762618 CCTCTTTAGCTGTGGCACCTCAG 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1067724902 10:48762620-48762642 AAGGCTGGCTCCCTGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067724896 Original CRISPR CTGAGGTGCCACAGCTAAAG AGG (reversed) Intronic
906771689 1:48490737-48490759 CTATGGTGCTACAGCTTAAGAGG - Intergenic
909905222 1:81186143-81186165 GTGATGTATCACAGCTAAAGAGG + Intergenic
910626482 1:89313321-89313343 CTGAGGGTTCACAGCAAAAGGGG + Intergenic
913294823 1:117309135-117309157 CATAGGTGCCACAGCTACAAGGG + Intergenic
915921675 1:159980468-159980490 CTGAGGAGCAAGGGCTAAAGTGG + Intergenic
916707064 1:167362211-167362233 CTCAGTTGCCACAGTAAAAGAGG + Intronic
918048147 1:180953721-180953743 CTGAGGTGCCTGAGGCAAAGGGG - Intergenic
918306483 1:183251327-183251349 CTGAGTTACCTCAGCTAGAGAGG + Exonic
921833049 1:219749914-219749936 CTGAGGTGTGACAGCAAAACCGG + Intronic
922650389 1:227333027-227333049 CTGAGGTCTCACAGCAACAGTGG + Intergenic
923606772 1:235451166-235451188 CTGAGGGGCCACAGCCTCAGGGG + Intronic
1062845128 10:697620-697642 CTGACGCCCCACAGCTACAGGGG + Intergenic
1063145372 10:3290728-3290750 CTGAGGTCCCACATCTACTGAGG - Intergenic
1067724896 10:48762596-48762618 CTGAGGTGCCACAGCTAAAGAGG - Intronic
1068386327 10:56332489-56332511 CTGAAGTGTCACAGATAAACTGG - Intergenic
1070750719 10:78962560-78962582 CTGAGGTGACACAGACAAAGGGG - Intergenic
1072221959 10:93334275-93334297 CAGAGGTGCTACAGGAAAAGCGG - Intronic
1078336141 11:10464778-10464800 GGGAGGTGCCACAGACAAAGAGG - Intronic
1081525651 11:43925763-43925785 CTGAGGTGACTCAGCTAGAAAGG - Intronic
1085428425 11:76425458-76425480 CTGAGGTCAGACAGCTACAGAGG + Intergenic
1089189987 11:116646743-116646765 GGGTGGTGCCACAGCTTAAGGGG - Intergenic
1089406670 11:118203250-118203272 CTGAGGAGCCACCTCTAAGGAGG + Intronic
1090020456 11:123123836-123123858 CTGAGCTGCCACAGCATTAGAGG - Intronic
1090076241 11:123581588-123581610 CTGAGGGGCCACAGGAAAAATGG - Intronic
1091367899 11:135037488-135037510 CTCAGTTTCCACAGCTGAAGGGG - Intergenic
1093772469 12:23033559-23033581 CTGAGGTGCCATCTCTGAAGAGG + Intergenic
1095407479 12:41882833-41882855 CTCAGGTGCCACTGCTCCAGTGG + Intergenic
1095724324 12:45435303-45435325 ATTAGGTGCAGCAGCTAAAGTGG - Intronic
1095971961 12:47908196-47908218 CTGTGGTGTCAGAGCTAGAGTGG + Intronic
1097332102 12:58342571-58342593 CTCAGGTGCCAGATCTAAAGAGG - Intergenic
1098617853 12:72552517-72552539 CTGAGATGGAACAGCTAGAGAGG + Intronic
1099877880 12:88431665-88431687 CTGAGGTACCATAGCTATTGAGG + Intergenic
1103961914 12:124614234-124614256 CTGAGGTGACACAGCCCAGGAGG + Intergenic
1104746493 12:131214204-131214226 CTGAGATGCCTCACCTAGAGAGG + Intergenic
1106631896 13:31482895-31482917 CTGCCAGGCCACAGCTAAAGAGG + Intergenic
1108426621 13:50308593-50308615 CTGAGGAGGAACAGCTAATGGGG + Intronic
1112004849 13:95245389-95245411 CTGAGGTTGCACAGCCAAACTGG + Intronic
1114781448 14:25542577-25542599 GGGAGGTGCCACAGGGAAAGGGG + Intergenic
1116639512 14:47443211-47443233 CTGAGGTGGAACAGCAAAACTGG - Intronic
1121040329 14:90741065-90741087 CCAAAGTCCCACAGCTAAAGGGG + Intronic
1121492307 14:94369282-94369304 CTGAAGGGCCAGAGCTAAAAGGG + Intergenic
1122289328 14:100671484-100671506 CTGAGCTACCACAGGTAAAGTGG + Intergenic
1125954553 15:43780839-43780861 TTGAGGTGCAACAGCAAAACTGG + Intronic
1125982116 15:44011945-44011967 TTCAAGTGCAACAGCTAAAGAGG + Intronic
1126008655 15:44282307-44282329 CAGAATTGCCTCAGCTAAAGAGG - Intergenic
1128562222 15:68676438-68676460 CTGAGGTGCCAGAGGGTAAGGGG + Intronic
1129192104 15:73943206-73943228 ATGAAGTGCCACAGTAAAAGTGG - Intronic
1129295838 15:74599596-74599618 CTCAGGAGCCACAGGCAAAGTGG - Intronic
1130549959 15:84884173-84884195 CTGAGGTCCCACAGCTGGAGGGG + Intergenic
1130563404 15:84976112-84976134 CTGAGGTCCCACAGCTGGATGGG - Intergenic
1131284411 15:91045187-91045209 CTGGGGTGACACAGCTGAAAGGG - Intergenic
1133959834 16:10483925-10483947 CTGAGGTACCACCTCTTAAGAGG - Intergenic
1137735180 16:50718624-50718646 CTGAGGTCACGCAGCTAATGAGG - Intronic
1139457281 16:67091506-67091528 CTAAGGTGACATAGCTGAAGTGG + Intronic
1143620020 17:8075412-8075434 CTGAGATGCCACTGCTCCAGGGG + Intronic
1143986147 17:10916090-10916112 ATGAGGTGCCGAAGCAAAAGGGG - Intergenic
1144637214 17:16917996-16918018 CTGAGGTGCCACAGCCCAAATGG - Intergenic
1149601455 17:57895712-57895734 CCCAGGTGCCACAGCTCTAGGGG + Intronic
1150818697 17:68417192-68417214 CTTAGGTGGAACAGCTAGAGTGG + Intronic
1150940610 17:69689215-69689237 TTGAGATTCCACAGCTAAACTGG + Intergenic
1156112557 18:33745523-33745545 CTGAGGTCAAACAGCAAAAGCGG + Exonic
1157551180 18:48582838-48582860 CTGAAGTGCCACATCTAGTGAGG + Intronic
1158888506 18:61851423-61851445 CTGAGCTGCCCCAGCTTCAGGGG + Intronic
1162043353 19:7983651-7983673 CTGAGGCGCCGCAGCCAAGGAGG - Intronic
1163281156 19:16318682-16318704 CTAAGGTCACACAGCTAATGTGG + Intergenic
1164637078 19:29799432-29799454 CAGAGGGGCCACAGGTAAGGAGG + Intergenic
1165186513 19:34027044-34027066 CTCAGGTCCCACAGCTAAAGTGG + Intergenic
1166044180 19:40219814-40219836 CCCAGGTCCCACAGCTAAGGAGG - Intergenic
1166736228 19:45086791-45086813 CTGATGTCACACAGCTAAACCGG + Intronic
1167467542 19:49658205-49658227 CAGATCTGCCACAGCAAAAGTGG + Exonic
927085852 2:19673382-19673404 CTGAGATGACAGAGCAAAAGGGG + Intergenic
927810993 2:26180063-26180085 CTGAAGTGCCACAGCCCTAGAGG - Intronic
929967411 2:46545613-46545635 CTGAGGTCACACAGCTACTGAGG + Intronic
930990879 2:57652500-57652522 CTTATGGGTCACAGCTAAAGAGG - Intergenic
931322741 2:61187611-61187633 CTGCCAGGCCACAGCTAAAGAGG + Exonic
931746088 2:65293077-65293099 TTGAGGTTACACAGCTAATGAGG + Intergenic
934575676 2:95399508-95399530 TTGAGGTGCGACAGCAAAACTGG - Intergenic
934651252 2:96092416-96092438 CTGAGGTCGCACAGCAACAGGGG + Intergenic
935386160 2:102501903-102501925 ATGAGGGGCCACAGCCAGAGGGG + Intronic
936329610 2:111536551-111536573 CTGAGGTCACACAGCTAACCTGG - Intergenic
937228945 2:120385609-120385631 CTGAGGTCACACAGCAAAAAAGG - Intergenic
937523465 2:122739030-122739052 CAGAGGTGGCACATCTAGAGAGG + Intergenic
943184680 2:184592582-184592604 CTGAGAAGCAACAGCTAAAAAGG - Intergenic
944880751 2:204010624-204010646 CTGAGATGCCACAGTTAATGAGG - Intergenic
946073729 2:217056246-217056268 CTCAGGAGCCACAGTTAAATTGG - Intergenic
947482026 2:230509579-230509601 CTGAGGGCCCACAGCTCTAGAGG + Intronic
1168826864 20:819833-819855 CGGAGGGGACACAGCTACAGAGG + Intergenic
1169920477 20:10729881-10729903 CTAAGGTCACACAGCTAAACTGG - Intergenic
1172873579 20:38150739-38150761 CTGAGGTCACACAGCAAAGGCGG - Intronic
1173766429 20:45614453-45614475 CTGAGGTTCCATAGGTAAAAGGG - Intronic
1174158162 20:48530540-48530562 TTTGGGGGCCACAGCTAAAGCGG - Intergenic
1174585254 20:51603315-51603337 CTGAGGTTCCAAAGCCATAGCGG + Intronic
1177063538 21:16401394-16401416 GTGGGGTGACACACCTAAAGAGG - Intergenic
1181584602 22:23846224-23846246 CTGAGGACACACAGCTAAAGAGG + Intergenic
1183670293 22:39268910-39268932 CTGAGGTGACAGAGCTACAAGGG + Intergenic
1184241710 22:43214455-43214477 CTGAGGTGCAGCAGCCAGAGGGG - Intronic
949125897 3:444961-444983 CTGAGGTGGCACAGGCCAAGTGG - Intergenic
950159213 3:10746841-10746863 CTGAGGTCACACAGCTAACCTGG - Intergenic
950189193 3:10964893-10964915 CTGAGGCTCCACAGCTAGAAAGG + Intergenic
950645465 3:14374203-14374225 CTGAGGTCACACAGCCCAAGTGG + Intergenic
950976464 3:17251219-17251241 CAAAGGTTCCACAGCTACAGTGG - Intronic
950988802 3:17408432-17408454 CTGAGTAGCCTCAGCTACAGTGG - Intronic
953345484 3:42171981-42172003 CTGGGCTGTCACAGCTAATGGGG - Intronic
954407923 3:50355764-50355786 CGGAGGTGCCTCAGCTATGGAGG - Intronic
956531827 3:70229036-70229058 CTTAGCCTCCACAGCTAAAGAGG + Intergenic
957518874 3:81293341-81293363 CTGAGATTCAATAGCTAAAGGGG + Intergenic
960464684 3:117982883-117982905 CTAATGTAACACAGCTAAAGTGG - Intergenic
963482324 3:145891760-145891782 CTGAGGTGACACAGGAAGAGCGG - Intergenic
966434487 3:179868232-179868254 CCCAGGTGACACAGCTAAAGAGG - Intronic
968972138 4:3801551-3801573 CAGAGGACCCATAGCTAAAGTGG + Intergenic
969180180 4:5434601-5434623 CTGAGGTGACACAGCTACTAAGG - Intronic
969256631 4:6006925-6006947 CTTTGGTGCTACAGGTAAAGTGG + Intergenic
971845706 4:31915663-31915685 CAGAGGTGGAACAGCTCAAGGGG + Intergenic
975073017 4:70167139-70167161 CTGGATTGCCACAGCAAAAGTGG - Intronic
976766046 4:88598725-88598747 CTCAGGTTTCACAGCTAACGTGG + Intronic
977430523 4:96926417-96926439 CTGAGGTGACAGGGGTAAAGTGG + Intergenic
978853616 4:113367968-113367990 CACAAGTGCCAGAGCTAAAGGGG + Intronic
978964481 4:114725024-114725046 CCAAGGTGCCACAGCCACAGAGG - Intergenic
984692934 4:182749072-182749094 CTCACGTCCCATAGCTAAAGAGG + Intronic
988798343 5:34673532-34673554 CTCAGATGCCACAGTAAAAGAGG - Intronic
992468548 5:77030825-77030847 CTGAGCTGGCCCAGCTAAGGCGG + Exonic
994103193 5:95916427-95916449 CTGAAAAGCCACAGCTACAGAGG + Intronic
994151709 5:96455535-96455557 CTTAGTTGCAACAGCTAAGGAGG + Intergenic
997356799 5:133267588-133267610 CTGGGGTGCCCTTGCTAAAGGGG + Intronic
998430427 5:142065490-142065512 CTGAGTTGCCATAGCAACAGAGG - Intergenic
1000299136 5:159939575-159939597 CTGAGGTTGCACAGCTAGTGAGG - Intronic
1000883473 5:166723459-166723481 TTGAGGTGCGACAGCAAAACTGG - Intergenic
1004865255 6:19847097-19847119 CTGAGGGGACACAGCTAACGAGG - Intergenic
1006624838 6:35390044-35390066 GTGGGGTGCCCCAGCCAAAGCGG + Intronic
1007123384 6:39402132-39402154 CTGAGGTGTCACTGCAAAAAGGG - Intronic
1007728292 6:43930129-43930151 CTGAGGTCACACAGCTCATGTGG + Intergenic
1009882084 6:69581135-69581157 TTGAGGAGCCTGAGCTAAAGTGG - Intergenic
1011099911 6:83709118-83709140 CGGAGGAGCCACAGCTGAGGTGG - Exonic
1014318360 6:119894683-119894705 CTGTGTTGCCACAGAAAAAGGGG + Intergenic
1015710166 6:136130587-136130609 CTTACCTGCCACAGCTGAAGTGG + Intronic
1016499500 6:144703512-144703534 CTGAGGAGCCACAACTTCAGAGG + Intronic
1017765325 6:157602578-157602600 CTGAGTTGCCAAGGCTAAATAGG + Intronic
1019070166 6:169338961-169338983 CTGGCCTGCCACAGCTAGAGGGG + Intergenic
1024554903 7:50595105-50595127 CTGAGGGCCCACAGCTGAAAGGG - Intronic
1025041536 7:55650304-55650326 CTGAGGTGGCTCAGTGAAAGGGG + Intergenic
1028267766 7:88748806-88748828 CTGAGGTCCCTAAGCAAAAGAGG - Intergenic
1029437573 7:100571628-100571650 CTTAGGTGCCACAGCTGGAAGGG - Intergenic
1031228740 7:119076316-119076338 CTGAGATCCTACAGATAAAGAGG + Intergenic
1032634132 7:133687625-133687647 GTCAGGTGCTACAGCCAAAGAGG - Intronic
1033416175 7:141163167-141163189 CTGAGGTGCCTTAGCTAGGGCGG + Intronic
1034270923 7:149803113-149803135 CTCAGGTGGCACAGGTAAGGGGG + Intergenic
1034896947 7:154882210-154882232 CCGAGGTGCCAAAGGGAAAGGGG + Intronic
1035236507 7:157500883-157500905 CCGAGGTGCCTGAGCTCAAGTGG - Intergenic
1035908353 8:3538396-3538418 CTGAGATGCCTCACCTAAAATGG + Intronic
1038876042 8:31550604-31550626 CTGAGGTGTGACAGCAAAACTGG + Intergenic
1042330680 8:67577207-67577229 CTGAGGGGATTCAGCTAAAGTGG - Intronic
1045198583 8:99955293-99955315 TTGAGTTGCCACATCTGAAGAGG + Intergenic
1052386437 9:27828799-27828821 CTGCAGTCCCACAGCTAATGAGG - Intergenic
1054854657 9:69885568-69885590 CTGAGGTGCTAGAACTGAAGAGG - Intronic
1055583301 9:77731012-77731034 CAGAGGAGCCCCATCTAAAGAGG + Intronic
1056876126 9:90332541-90332563 CCGAGTTGCCACAGAGAAAGAGG - Intergenic
1057389461 9:94630615-94630637 CTGAGTTGATACAGGTAAAGTGG + Intronic
1058172195 9:101695198-101695220 CTGATGTGCAAGAGCTAGAGTGG + Intronic
1058242303 9:102580099-102580121 TTGAGGTGCCACAGCTCCAATGG - Intergenic
1059128368 9:111717084-111717106 CTGAGGTCCCACTGCTTTAGAGG + Intronic
1059142261 9:111864583-111864605 CTGTGGTGCCACTACTCAAGAGG + Intergenic
1059325684 9:113502839-113502861 CTCAAAAGCCACAGCTAAAGAGG - Intronic
1060423306 9:123484877-123484899 CCCAGGTGCCACAGCTAGGGAGG - Intronic
1061281051 9:129597742-129597764 CTGAGGTCCCACAGCGCAGGCGG - Intergenic
1061821131 9:133227740-133227762 GTGAGGTGCCTCAGCTAGAGGGG - Intergenic
1061841851 9:133363201-133363223 CTGAGATGCCACAGCCAAGCGGG + Exonic
1062238128 9:135522330-135522352 CTGAGGTGCCTCGGCTGGAGGGG + Intronic
1186044967 X:5525883-5525905 CCGTGGTGCCACAGCTGATGGGG - Intergenic
1188534392 X:31180243-31180265 CAGATGTTCCCCAGCTAAAGTGG - Intronic
1188970125 X:36605236-36605258 CTGGGTTGCCACAGAGAAAGAGG - Intergenic
1192235950 X:69296172-69296194 CTGAGGTGGGTCAGCTAAGGTGG + Intergenic
1194996325 X:100595220-100595242 CTTAGTTGCCAAATCTAAAGTGG + Intronic
1197098783 X:122626780-122626802 CTGAGGTGCCATGGCAAAAGTGG + Intergenic
1197173060 X:123455876-123455898 CTTAGGTCACACAGCTAATGAGG - Intronic
1197769665 X:130082128-130082150 TTGAGGGGCCACATCTACAGAGG + Intronic
1198055496 X:132990759-132990781 TTGAGGTTCCACAGCTAAGATGG - Intergenic
1198699401 X:139381681-139381703 CAAAGGTGCCACAGCCACAGAGG - Intergenic
1199421288 X:147647748-147647770 CTAAGGTCACACAGCTTAAGTGG - Intergenic
1199929499 X:152504085-152504107 CAGAGCTGCCAAAGCTACAGGGG - Intergenic
1199937881 X:152594862-152594884 CTGAGCTGCACCAGCCAAAGAGG - Intergenic
1201400880 Y:13602624-13602646 CTGAGGTGTCAGAGCCCAAGTGG - Intergenic