ID: 1067724899

View in Genome Browser
Species Human (GRCh38)
Location 10:48762613-48762635
Sequence CCAGGGAGCCAGCCTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 451}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067724899_1067724907 9 Left 1067724899 10:48762613-48762635 CCTCAGCAAGGCTGGCTCCCTGG 0: 1
1: 0
2: 4
3: 52
4: 451
Right 1067724907 10:48762645-48762667 CCTAAGCTGGCTTAGCTGAGTGG No data
1067724899_1067724909 19 Left 1067724899 10:48762613-48762635 CCTCAGCAAGGCTGGCTCCCTGG 0: 1
1: 0
2: 4
3: 52
4: 451
Right 1067724909 10:48762655-48762677 CTTAGCTGAGTGGCATACCTGGG No data
1067724899_1067724910 20 Left 1067724899 10:48762613-48762635 CCTCAGCAAGGCTGGCTCCCTGG 0: 1
1: 0
2: 4
3: 52
4: 451
Right 1067724910 10:48762656-48762678 TTAGCTGAGTGGCATACCTGGGG No data
1067724899_1067724905 -4 Left 1067724899 10:48762613-48762635 CCTCAGCAAGGCTGGCTCCCTGG 0: 1
1: 0
2: 4
3: 52
4: 451
Right 1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG No data
1067724899_1067724911 26 Left 1067724899 10:48762613-48762635 CCTCAGCAAGGCTGGCTCCCTGG 0: 1
1: 0
2: 4
3: 52
4: 451
Right 1067724911 10:48762662-48762684 GAGTGGCATACCTGGGGCCTTGG No data
1067724899_1067724908 18 Left 1067724899 10:48762613-48762635 CCTCAGCAAGGCTGGCTCCCTGG 0: 1
1: 0
2: 4
3: 52
4: 451
Right 1067724908 10:48762654-48762676 GCTTAGCTGAGTGGCATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067724899 Original CRISPR CCAGGGAGCCAGCCTTGCTG AGG (reversed) Intronic
900143350 1:1147482-1147504 CCGAGGTGCCAGCCCTGCTGAGG + Intergenic
900153944 1:1196567-1196589 GCAGGGAGGCATCCTGGCTGCGG - Intronic
900243826 1:1628825-1628847 CCAGGGAGCCAGGCGTTCTGGGG + Intronic
900369131 1:2323704-2323726 CCCTGCAGCCGGCCTTGCTGGGG + Intronic
900628898 1:3623540-3623562 CCGGGGAGACAGCCTCCCTGTGG + Intergenic
900978907 1:6035208-6035230 CCAGGGAGCCAGTGTGGCAGGGG + Intronic
901022912 1:6264037-6264059 CCAGGGAGCCAGGGTGTCTGGGG + Intergenic
902217824 1:14945549-14945571 CCGGGGAGCCAGCCGGGGTGGGG - Intronic
902234394 1:15048304-15048326 CCAGCCATCCACCCTTGCTGGGG + Intronic
902250680 1:15152959-15152981 ACCGGGAGCCTGCCCTGCTGAGG - Intronic
902555897 1:17246379-17246401 CCTGGGAACCAGCCCTGCTGGGG - Intergenic
903019545 1:20384544-20384566 GCAGGGAGCCCCCCTTCCTGTGG + Intergenic
903859326 1:26355411-26355433 CCTGGGGTCCAGCCTGGCTGTGG + Intergenic
904255404 1:29251493-29251515 GCTGGGAGCCAGGCTGGCTGAGG + Intronic
905648540 1:39640805-39640827 CCAGCAAGCAGGCCTTGCTGTGG - Intergenic
906201907 1:43965964-43965986 CCAAGGAGCCAGTGCTGCTGTGG - Intronic
907269085 1:53280132-53280154 CCAGGGCGCCAGCAATGCTGGGG - Intronic
907428673 1:54397572-54397594 CCAGGGAGCCAGCCTCACTGAGG + Intronic
907581303 1:55575015-55575037 CCAGGGATCCAGGATTGCTCAGG - Intergenic
908260955 1:62338968-62338990 CCTGAGAGCCAGACTTTCTGGGG - Intergenic
910438515 1:87229282-87229304 CCAGGGCCCAAGCCTGGCTGAGG + Intergenic
911517188 1:98881322-98881344 CAAGGCAGCAAGCCTGGCTGGGG - Intergenic
912161110 1:106986412-106986434 CCCGGGAGCCAGTCTTGTGGGGG + Intergenic
913217700 1:116634429-116634451 GCATGAAGCCAGGCTTGCTGTGG - Intronic
915242316 1:154532280-154532302 CCAGTGGGCCAGCACTGCTGCGG + Intronic
915264742 1:154708885-154708907 CAAAGGAGGCTGCCTTGCTGAGG + Intronic
915284328 1:154843225-154843247 GCAGGGAGCCAGCCCTGGTTGGG - Intronic
915613360 1:157014048-157014070 CAAGGTCTCCAGCCTTGCTGAGG + Intronic
917438466 1:175044796-175044818 CCAGGGCGCCAGCCTGACAGTGG - Intergenic
921101304 1:211931574-211931596 CCAGGGTGCCAGTTTTACTGCGG + Intergenic
922007234 1:221543751-221543773 ACAGGGTGCCAGACTTACTGGGG + Intergenic
922722938 1:227907871-227907893 GCAGGGTGCCACCCTTGGTGAGG - Intergenic
924809271 1:247387096-247387118 CCAGAGAGGCCGGCTTGCTGTGG - Intergenic
924835680 1:247644720-247644742 GAAGGGAGCCAGCCTTGGAGGGG + Intergenic
1062760256 10:12082-12104 CCAGGGAGCCAGGGTGGGTGCGG - Intergenic
1062813609 10:483466-483488 GCAGGGAAACAGCCTCGCTGGGG + Intronic
1063568454 10:7193009-7193031 CCTGGGTGCCAGGCTTCCTGGGG + Intronic
1064175935 10:13075069-13075091 TCAGGGAGCCAGGTTTGCAGTGG - Intronic
1067172568 10:43920488-43920510 CCAGGCAGCAAGCCTGGCTAGGG - Intergenic
1067181015 10:43986088-43986110 CCAGGAAACCAGGCTTGCAGTGG - Intergenic
1067193358 10:44091308-44091330 CAAGGCAGCAAGCCTGGCTGGGG + Intergenic
1067724899 10:48762613-48762635 CCAGGGAGCCAGCCTTGCTGAGG - Intronic
1069878141 10:71575654-71575676 CCAGGGAGCCAGTCCAGCTGGGG - Intronic
1069881353 10:71595754-71595776 CCAGAGGCCCAGCCTTGATGTGG + Intronic
1069886613 10:71627773-71627795 CCATGGTGCCAGCCCTGCTCAGG - Intronic
1070790832 10:79188391-79188413 CCCCCGAGCCAGTCTTGCTGGGG + Intronic
1070851862 10:79570779-79570801 CGAGGCAGCAAGCCTGGCTGGGG + Intergenic
1071003767 10:80859412-80859434 CCAGTGGGCCAGCACTGCTGGGG - Intergenic
1071085348 10:81862877-81862899 CCAGTGGGCCAGCACTGCTGGGG + Intergenic
1071713833 10:88075251-88075273 CCCTGGAGCCAGACTGGCTGGGG + Intergenic
1072694142 10:97590619-97590641 TGTGTGAGCCAGCCTTGCTGGGG - Exonic
1073212840 10:101818614-101818636 CCAGGGTGCCAGGCTTGTTTCGG - Intergenic
1073245819 10:102089228-102089250 TCATGGAGCCAGTCTTGTTGAGG - Intergenic
1073496661 10:103897703-103897725 CCAGGGCGCCTGGATTGCTGCGG + Exonic
1074164277 10:110860981-110861003 CCTGGGATCCAGCATGGCTGCGG + Intergenic
1074882475 10:117669614-117669636 CCAGAGAGCCACGCTTGCTGGGG - Intergenic
1075342882 10:121661496-121661518 CCTGGGAGCCCTCCTTCCTGGGG - Intergenic
1075633923 10:124017742-124017764 TCAGGGAGGCAGCCTTCCTCTGG - Intronic
1076133668 10:128030203-128030225 CCAGGGCAGCAGCCATGCTGCGG - Intronic
1076426409 10:130370362-130370384 TCAGGAAGCCAGCTCTGCTGTGG + Intergenic
1076534401 10:131167581-131167603 CAACAGAACCAGCCTTGCTGAGG + Intronic
1076544988 10:131239140-131239162 CCTGGGACCCAGCCTTGCTCCGG + Intronic
1076697429 10:132253669-132253691 CCAGGGAGCCTGCGGAGCTGAGG + Intronic
1077008751 11:370780-370802 CCAGGGAGCCAGGTGTCCTGAGG + Intronic
1077072170 11:680212-680234 CTGGAGAGGCAGCCTTGCTGTGG - Intronic
1077108892 11:853513-853535 CCAGGCAGGCATCTTTGCTGGGG + Intronic
1077219885 11:1411183-1411205 TCACTGAGCCAGCCTTGCTGAGG + Exonic
1077222767 11:1424789-1424811 CCAGGGAGCCCACCTGGCAGAGG - Intronic
1077430943 11:2515755-2515777 CCAGGGAGCCAGGCTTGGTGTGG + Intronic
1077602311 11:3582077-3582099 CCTGGGACCCAGCCGTGCAGGGG + Intergenic
1077747149 11:4919449-4919471 CCAGGGAGCCAGGCCTGCTAGGG - Intronic
1079104412 11:17561206-17561228 TCTGGGGGCCAGGCTTGCTGCGG + Intronic
1080204430 11:29712819-29712841 CCAGTGGGCCAGCACTGCTGGGG - Intergenic
1080828216 11:35866045-35866067 CCAGGGAGCCATCATTGATATGG + Intergenic
1081125070 11:39312001-39312023 CCAGTGGGCCAGCACTGCTGGGG - Intergenic
1081126929 11:39333257-39333279 CCAGTGGGCCAGCACTGCTGGGG + Intergenic
1083679568 11:64344901-64344923 CCTGGGAGCAAGCCCGGCTGCGG + Exonic
1083953278 11:65968623-65968645 CAGAGGAGCCAGCCTTGCGGGGG + Intronic
1083989821 11:66240132-66240154 ACAGTGAGGCAGCCCTGCTGAGG + Intronic
1084255379 11:67938606-67938628 TCATGCAGCCAGCCTGGCTGTGG - Intergenic
1084258204 11:67956628-67956650 CCTGGGACCCAGCCGTGCAGGGG + Intergenic
1085298436 11:75444264-75444286 ACAGGGTGCCTGCCCTGCTGTGG + Intronic
1085309915 11:75510173-75510195 CCATGGCCCCAGCCCTGCTGGGG + Intronic
1085322850 11:75585299-75585321 CTTGGGAGCCAGCTTTGGTGGGG + Intergenic
1085455206 11:76661581-76661603 CCAGGAACCCTGCCTGGCTGGGG + Intronic
1085556182 11:77424201-77424223 CCAGGAACCCAACCTTGCAGGGG + Intronic
1089147477 11:116340359-116340381 TCAGGGACCCAGCCTTGCACTGG + Intergenic
1089963283 11:122634868-122634890 CCACGGAGCCAGCCTTGGTTTGG + Intergenic
1090799669 11:130162357-130162379 CCAGGGAGCCTGCCTCCCTGAGG + Intronic
1091262553 11:134245823-134245845 CCTGGAAGCCAGCCTCTCTGGGG + Exonic
1091858117 12:3755401-3755423 CCAGGAAGCCAGCCTTGCCTCGG - Intronic
1092140512 12:6180396-6180418 CCAGTGAGTCAGCCGGGCTGGGG - Intergenic
1092180433 12:6443122-6443144 CCAGGGAGCCAGCCTAGGATGGG + Intergenic
1092517140 12:9226433-9226455 CAAGGCAGCAAGCCTGGCTGGGG - Intergenic
1093261325 12:16940902-16940924 CCAGGCAGGCAGCCTTGGTAGGG + Intergenic
1095903934 12:47357876-47357898 CCAGGGTGCCAACCGTGCAGCGG + Intergenic
1097698643 12:62798739-62798761 CCAGTAAGCCACCATTGCTGTGG - Intronic
1099740379 12:86627145-86627167 CCAAGCAGCAAGCCTGGCTGGGG + Intronic
1100359186 12:93860611-93860633 CGAGGGAGGGAGCCGTGCTGAGG + Intronic
1101461954 12:104905700-104905722 CCGGTGGGCCAGCATTGCTGGGG + Intronic
1102016395 12:109650799-109650821 CCAGGGTGCCAGCCTGGCCTAGG - Intergenic
1102591255 12:113958412-113958434 CCACGCAGCCAGCCCTGATGAGG - Intronic
1103600641 12:122052510-122052532 GCAGGGACCCAGTGTTGCTGGGG - Intronic
1103767224 12:123288973-123288995 TCAGGGAGCCAGCCAGGGTGGGG - Intergenic
1104939026 12:132386286-132386308 CCAGGAATCCAGGCTTGCTCTGG - Intergenic
1104986487 12:132600497-132600519 TCAGGGACACAGCCTTGCTGTGG - Intergenic
1105495087 13:20923456-20923478 CAGTGGAGCCAGCCCTGCTGAGG - Intergenic
1106197807 13:27509164-27509186 TCAGGGAGCCAGCCTTGGGAGGG + Intergenic
1106872601 13:34037849-34037871 TCAGGGAGCCAGCCTAGAGGAGG - Intergenic
1107448809 13:40490487-40490509 CCAGGCAGCCGGCTTTCCTGAGG + Intergenic
1108696479 13:52906703-52906725 CGAGGGAGCCAGTCCTGCTTTGG + Intergenic
1109111008 13:58318724-58318746 CCAGTGGGCCAGCATTGCTGGGG + Intergenic
1109659141 13:65435803-65435825 CCAGGTGGCAAGCCTAGCTGGGG + Intergenic
1109963888 13:69667147-69667169 CCAAGAAGGCAGCCTGGCTGGGG + Intergenic
1111173922 13:84567248-84567270 CCAGGGGGCCAGCATGGCTGTGG + Intergenic
1113362247 13:109642393-109642415 CCAGGAAGCCTCCCTTGTTGAGG - Intergenic
1113421834 13:110176939-110176961 CCATGGAGCCAGGCTTGCCAGGG + Exonic
1113579723 13:111420504-111420526 GCATGGAGCCAGCATGGCTGGGG + Intergenic
1113644647 13:111984816-111984838 CAAGGCAGACAGCATTGCTGTGG + Intergenic
1114031592 14:18584486-18584508 CCAGGGAGCCAGGGTGGGTGTGG - Intergenic
1116492884 14:45526893-45526915 CCAGGGCTCCTGCCTCGCTGTGG + Intergenic
1117088342 14:52224043-52224065 CCAGGGATCCAGCATGGCAGCGG + Intergenic
1117407467 14:55418187-55418209 GCAGGAATCCAGCCCTGCTGAGG - Intronic
1118860441 14:69658855-69658877 GCAGGGAGCCAGTCCTTCTGAGG + Intronic
1119479049 14:74948430-74948452 CCTGGGACCCATCTTTGCTGAGG + Intronic
1120632300 14:86905618-86905640 CCGGTGGGCCAGCATTGCTGGGG + Intergenic
1120704760 14:87734940-87734962 CCAGTGGGCCAGCACTGCTGGGG + Intergenic
1121112947 14:91324739-91324761 CCGGGGAGCCAGCCTGGCCGTGG - Intronic
1121201667 14:92122747-92122769 ACAGGAAGCCAGACTTGCCGGGG - Intronic
1121274637 14:92659240-92659262 GCAGCGAACCATCCTTGCTGTGG - Exonic
1121314140 14:92951146-92951168 CCAGGGAGCCTGCTGTTCTGAGG - Intronic
1121439016 14:93937128-93937150 CCCTGGAGCCAGCCTTGCCAGGG - Intronic
1121728177 14:96167979-96168001 AGAGGAACCCAGCCTTGCTGAGG - Intergenic
1122321145 14:100856586-100856608 CCAGGGAGACAGCCTCACTCAGG + Intergenic
1124435479 15:29645452-29645474 GCAGGGAGGCATCATTGCTGCGG - Intergenic
1126636095 15:50781184-50781206 CTAGAGAGCAAACCTTGCTGGGG + Intergenic
1127555848 15:60086798-60086820 CAAGGAAACCAGCCTTGCTCTGG + Intergenic
1127655104 15:61048359-61048381 CCAGTGAGCCAGGCCTTCTGAGG + Intronic
1128566595 15:68704803-68704825 CCAGCAAGCCTGCCTTGCTGGGG - Intronic
1128598563 15:68975857-68975879 CCAGTGGGCCAGCACTGCTGGGG + Intronic
1128845563 15:70891906-70891928 CCAGGCAGCCAGGCATTCTGAGG - Exonic
1129457388 15:75683116-75683138 CCAGGGCTCCAGTCCTGCTGCGG + Intronic
1129529888 15:76257174-76257196 CCTGGGCCCCAGCCTTGGTGGGG - Intronic
1129697952 15:77751319-77751341 AAAAGCAGCCAGCCTTGCTGAGG - Intronic
1129726403 15:77903829-77903851 CCAGGGCTCCAGTCCTGCTGTGG - Intergenic
1131189911 15:90306295-90306317 CCAAGAAGCCAGACTTCCTGGGG - Intronic
1131827238 15:96331405-96331427 CCAGGGAGCCAGGCAGGCCGGGG - Exonic
1132365316 15:101252270-101252292 CTCGGGAGCCAGCCTTGCAGTGG + Intergenic
1132714415 16:1283692-1283714 TCAGGGAGCCAGCGTGGCTGGGG + Intergenic
1132748590 16:1447142-1447164 GCAGGGAGCCAGCTTGGGTGAGG - Intronic
1132956726 16:2598231-2598253 CCAGGGAGGGAGCCCTGCGGGGG + Exonic
1133456896 16:5950293-5950315 CCAGGAAGCCAGCCCTGCCATGG + Intergenic
1134045140 16:11095464-11095486 CCAGGCAGTCAGCATAGCTGAGG + Intronic
1134097123 16:11425206-11425228 CCATGCAGCCAGCCTGGCTCTGG - Exonic
1134635797 16:15790824-15790846 TCATGAAGCCAGCCTGGCTGGGG - Intronic
1135221164 16:20614979-20615001 CCAGGGAGCCAGCCCACCTCTGG - Intronic
1135505110 16:23029669-23029691 CCAGGGAGCCTTCTTTGGTGAGG - Intergenic
1135526062 16:23214634-23214656 GGAGGGAGACAGCCATGCTGAGG + Intronic
1138350816 16:56345389-56345411 CCAGGGGCCCTGCCTGGCTGGGG - Exonic
1140069254 16:71634908-71634930 GCAGCGAGCCAGCGTTGGTGTGG + Intronic
1141132622 16:81445783-81445805 CCAGGCACCCAGCCTGGCGGTGG - Intronic
1142123960 16:88401021-88401043 GGAGGGAGCCAGGCTTGGTGGGG - Intergenic
1142256372 16:89015645-89015667 CTTGGCAGCCAGCCTTGCTGAGG - Intergenic
1142421401 16:89972674-89972696 CCAGGCCGCTGGCCTTGCTGTGG + Intergenic
1142743484 17:1943418-1943440 CCATGGGGCCAGCCCTGCTCAGG - Intronic
1142978188 17:3657370-3657392 CCCCGGACCCAGCCTTGGTGGGG - Intronic
1143057868 17:4175936-4175958 CCAAGGACCCCGCCTTCCTGGGG - Intronic
1143153745 17:4822903-4822925 GCAGGGAGCCAGACGTGGTGGGG - Exonic
1143164870 17:4892728-4892750 CCAGTGAGCCAGCCTGGGGGAGG - Exonic
1143337098 17:6179524-6179546 CCAAAGGGGCAGCCTTGCTGAGG - Intergenic
1144103167 17:11961961-11961983 CCAGGCTGCCAGGCCTGCTGTGG - Exonic
1144703946 17:17355275-17355297 CCAGGGCGCCAGCCAGACTGAGG + Intergenic
1144726164 17:17503777-17503799 CCAGGGAACCAGGCTTCCTCCGG + Intergenic
1144758452 17:17694195-17694217 CCGGGGAGGCAGCCGTGCTGAGG + Intronic
1145009544 17:19360027-19360049 CCAGTGAGCCAGCCTGGACGTGG - Intronic
1145055915 17:19703989-19704011 CCAGCATGCCAGCCTTCCTGTGG + Intronic
1146891821 17:36511304-36511326 GAAGGTAGCCAGCATTGCTGGGG - Intronic
1147427404 17:40352477-40352499 CCAGGCAGGCAGCCTTGAGGAGG - Exonic
1147560711 17:41507261-41507283 CCAAGGGGCCAGGGTTGCTGTGG + Intergenic
1147953351 17:44119248-44119270 ACTGGGTGCCAGCCTTGGTGTGG - Intronic
1148676857 17:49450826-49450848 CCACAGAGCCTGCCTTCCTGGGG - Intronic
1149421038 17:56511029-56511051 CCACGCTGCCAGCCTTCCTGAGG + Intronic
1149522789 17:57330781-57330803 CCAGGGTGCCACCCCAGCTGTGG - Intronic
1150677568 17:67258028-67258050 ACAGGAAGCCAGGCTTCCTGGGG + Intergenic
1151355328 17:73554781-73554803 CCAGGAAGCCAGCTGTGCTGTGG + Intronic
1151655693 17:75494994-75495016 GCAGGGAGCCTGCGTGGCTGGGG - Exonic
1151963101 17:77417848-77417870 CCAGGAACCCAGCCTTGCTCGGG + Intronic
1152449287 17:80366147-80366169 CGAGGGAGCCAGCCTCACGGCGG - Intronic
1152953164 18:12436-12458 CCAGGGAGCCAGGGTGGGTGCGG - Intergenic
1153410761 18:4789869-4789891 CCAGGGTGCCAGCCTCCATGTGG - Intergenic
1154085654 18:11303048-11303070 ACAGGAAGCCAGGCTTGCAGGGG - Intergenic
1156151322 18:34246814-34246836 CCAGGGTGCCAGCCTCCATGTGG + Intergenic
1156495614 18:37523505-37523527 CTGGGGAGACAGGCTTGCTGGGG + Intronic
1156503724 18:37575960-37575982 CCTGGGAGCCTGCCTTGCTGGGG + Intergenic
1157535885 18:48457078-48457100 CCAGGGCGTCAGCCTCCCTGGGG - Intergenic
1157691474 18:49685538-49685560 CCAGGCAGTCAGTCTTGGTGTGG - Intergenic
1157745330 18:50130098-50130120 CCTGGCACTCAGCCTTGCTGTGG - Intronic
1158247895 18:55452500-55452522 CCAGGGTGCCAGGCCTGCTCTGG + Intronic
1158393421 18:57061895-57061917 CCAGGGAGCTGGGCCTGCTGGGG + Intergenic
1158729732 18:60010156-60010178 CCAGGGGGCCAGCCTGACAGTGG - Intergenic
1160046405 18:75391081-75391103 CCAGGGTGCCATCCCAGCTGTGG - Intergenic
1160092042 18:75836623-75836645 CCAGGCAGCTGGCATTGCTGTGG - Intergenic
1160983725 19:1828035-1828057 CCCGGGAGCTGGCCCTGCTGAGG + Exonic
1161062421 19:2221912-2221934 CCAAAGAGAAAGCCTTGCTGTGG - Intronic
1161389728 19:4014798-4014820 CCAGGGAGGCAGCGTTGATGGGG + Intronic
1161551492 19:4915283-4915305 CCAGGGAGCCATCCTGGGGGAGG - Intronic
1162453201 19:10766929-10766951 CCAGGGAGCCCTCCTGGCTCAGG + Intronic
1162600227 19:11663237-11663259 GCAGGGAAACAGGCTTGCTGAGG + Intergenic
1162772195 19:12955969-12955991 CCAGGAAGCCAGTGTGGCTGGGG - Intronic
1163630713 19:18416851-18416873 CCAGGGCGCACGCCTTGCGGGGG - Intergenic
1163649461 19:18508935-18508957 CAAGGCAGCAAGCCTTGTTGTGG + Intronic
1164394813 19:27853097-27853119 CAAGGCAGCAAGCCTGGCTGGGG + Intergenic
1164527815 19:29024712-29024734 CCAAGGATCCAGCCTTTCAGGGG + Intergenic
1164810238 19:31149472-31149494 CCAGGCAGCCAGGCTGGCTTCGG + Intergenic
1164847639 19:31448271-31448293 CCAGGGAGCCCAGCTGGCTGGGG - Intergenic
1165043929 19:33089336-33089358 CTGAGGAGCCAGTCTTGCTGTGG - Intronic
1165247357 19:34505138-34505160 TCTGGGAGCCAGCCTGGGTGGGG + Exonic
1165388898 19:35527315-35527337 CCAGGGGGCCCACCATGCTGCGG - Exonic
1165388916 19:35527369-35527391 CCAGGGGGCCCACCATGCTGCGG - Exonic
1165388961 19:35527531-35527553 CCAGGGGGCCCACCATGCTGCGG - Exonic
1165718634 19:38063307-38063329 GCAGGGAGCCTTCCTGGCTGTGG + Intronic
1166163689 19:40971216-40971238 CCAGGTGGCAAGCCTGGCTGAGG - Intergenic
925165917 2:1715609-1715631 CCAGAGAGCCAGCCAACCTGTGG - Intronic
925317984 2:2939930-2939952 CCATGCAGCCAGCCCTGCGGAGG - Intergenic
925362432 2:3288907-3288929 CCAGGGGGCCAGGGCTGCTGGGG - Intronic
926018411 2:9474367-9474389 CCCTGGGGGCAGCCTTGCTGTGG + Intronic
926345343 2:11939880-11939902 CCAGGGATCTTGCCTTTCTGGGG + Intergenic
927128478 2:20035980-20036002 CCAAGGAGACAACCTGGCTGGGG - Intronic
927653214 2:24924643-24924665 CCAGGGAGCCAGCTTTCCCTAGG - Intergenic
927940196 2:27098752-27098774 CCAGGGAGCCAGCATGGCGGTGG + Intronic
927998851 2:27506087-27506109 CTAGGGAGCCAGGCTAGCTTTGG - Intronic
928220498 2:29399317-29399339 CCAAGGACTCACCCTTGCTGTGG - Intronic
929070065 2:38020684-38020706 CCAGTGAGCCAGCACTGCTGGGG - Intronic
929279446 2:40062016-40062038 CCAGCCAGCCAGCCTGCCTGAGG + Intergenic
929587049 2:43123160-43123182 CCAGGGAACCAGACTGGCTTAGG - Intergenic
929873131 2:45774652-45774674 CCAGGGAGACAGACAGGCTGTGG + Intronic
929920613 2:46168795-46168817 GCTGGGAGCCAGCGTTTCTGTGG + Intronic
930818190 2:55620066-55620088 CCATGAAGCCAGCCCTGCTCTGG - Intergenic
930907529 2:56590029-56590051 CCAAGCAGTCAGCCTGGCTGTGG - Intergenic
931941654 2:67258303-67258325 TCAGTGAGCCAGCGTTGCTTAGG + Intergenic
932315452 2:70778902-70778924 CCACTGAGCCAGGCTTGGTGAGG + Intronic
933697546 2:85231149-85231171 CCAGGAAGCCAGGCCTGTTGAGG + Intronic
933862921 2:86487926-86487948 GCAGGCAGCCAGTCCTGCTGAGG + Intronic
935294642 2:101638367-101638389 CCATCGAGCCAGGCATGCTGTGG - Intergenic
938061463 2:128258387-128258409 CCACTGAGCCAGCAATGCTGAGG - Intronic
938070579 2:128306208-128306230 CCAGCGTGCTAGCCCTGCTGAGG - Intronic
940865279 2:158811664-158811686 ACAAGGATCCTGCCTTGCTGTGG - Intronic
941914197 2:170798314-170798336 CCAGGGAGCCTGCTCTGCTCGGG - Intronic
943796708 2:192005598-192005620 CCAGAAAGCCAGCCTCACTGCGG - Intronic
943941438 2:194002928-194002950 CCAGTGGGCCAGCACTGCTGGGG + Intergenic
944443020 2:199761720-199761742 CCAGGAAGACAGCATGGCTGGGG - Intronic
945038627 2:205726008-205726030 CCATGGAGCCGGCTTTGTTGAGG - Exonic
946308210 2:218868150-218868172 CCAGGCAGCCAGCCAGCCTGGGG + Intronic
946331957 2:219014481-219014503 CAAGAGTGCCAGCCCTGCTGGGG - Intronic
946394210 2:219435096-219435118 CCGGGGCGCCAGTCTTCCTGCGG + Exonic
948177898 2:235958539-235958561 GCAGGGAGCTCGCCTTGGTGAGG - Intronic
948494244 2:238336368-238336390 GCAGAGTGCCAGCTTTGCTGGGG - Intronic
948591914 2:239055882-239055904 TCCTGGAGCCAGCCTTGCTGGGG + Intronic
948760930 2:240190663-240190685 GCAGGGAGCCACCCTTCCTGTGG + Intergenic
948767691 2:240231974-240231996 CCAGGGAGTCGGCTTTGTTGGGG + Intergenic
948839660 2:240642687-240642709 CCTGGAGGCCAGCCTGGCTGGGG + Intergenic
948842632 2:240662479-240662501 CTAGGGAGCAAACATTGCTGTGG - Intergenic
948901296 2:240958045-240958067 CCAGCCAGCCGGCCTTCCTGGGG + Intronic
1168829256 20:835680-835702 CCCAGGAGTCAGCCTTGCTCAGG - Intronic
1168833460 20:860400-860422 CTAGGGAGACAGCACTGCTGGGG + Intergenic
1169130585 20:3164675-3164697 CCAGGGTGCCAGCTTCGCCGAGG - Exonic
1170531404 20:17296163-17296185 CAAGGGAGCCTGCTTTGCTTAGG - Intronic
1171205093 20:23272870-23272892 CCAGGGAGCAAACCCTCCTGTGG + Intergenic
1171517667 20:25750660-25750682 CCTGGGAACCAGCCTGGGTGGGG + Intergenic
1172099159 20:32475187-32475209 TCAGGGCGCCAGGCCTGCTGGGG - Intronic
1173402208 20:42735741-42735763 GCTGGGAGCCAGCCCTGCTCTGG + Intronic
1174035290 20:47664994-47665016 TCTGGGCGCCAGCCTGGCTGAGG + Intronic
1174068466 20:47883131-47883153 CCAGGGCTTAAGCCTTGCTGTGG - Intergenic
1174417992 20:50380186-50380208 CCAGGAAGCCAGCCCTAATGAGG + Intergenic
1175082571 20:56433361-56433383 CCAGGGTGTCACCCTTTCTGAGG - Intronic
1175127016 20:56760015-56760037 CCTGGGAGGCAGCCAGGCTGTGG - Intergenic
1175951213 20:62584383-62584405 CCAGGCAGCCAGCAGTTCTGGGG - Intergenic
1175955461 20:62606832-62606854 CCACAGAGGCAGCCGTGCTGGGG - Intergenic
1176075854 20:63247920-63247942 CCAGGGCTCCAGCCATGGTGGGG + Intronic
1176149586 20:63583072-63583094 CCAGGGAGCCCCTCCTGCTGGGG + Intergenic
1176872246 21:14093158-14093180 CCAGTGGGCCGGCATTGCTGGGG + Intergenic
1176899082 21:14417708-14417730 CCAGGAAGCCAGCTCTGCAGTGG + Intergenic
1176971937 21:15276455-15276477 CCTGGGAGCCACCCATCCTGTGG + Intergenic
1178508209 21:33180330-33180352 GCAGGATGCCAGCGTTGCTGGGG - Intergenic
1179188636 21:39105021-39105043 CTAGGGTGCCAGCATGGCTGGGG + Intergenic
1179227263 21:39465241-39465263 CCACAGAGCCAGCCTGGCTCAGG - Intronic
1180080251 21:45483390-45483412 CCATGGACCCAGCCTTCCTTCGG + Intronic
1180107880 21:45631738-45631760 CTAGCAAGCCAGCCTTGATGAGG + Intergenic
1180455704 22:15511543-15511565 CCAGGGAGCCAGGGTGGGTGTGG - Intergenic
1180819011 22:18812499-18812521 GCATGAAGCCAGGCTTGCTGTGG - Intergenic
1180831512 22:18909334-18909356 CCAGGGACCCCTCCTTCCTGGGG + Intronic
1181014767 22:20062512-20062534 CCAGTGAGGCAGCGATGCTGAGG - Intronic
1181054647 22:20254995-20255017 GCAGCGAGACAGCCATGCTGGGG + Intronic
1181205235 22:21246947-21246969 GCATGAAGCCAGGCTTGCTGTGG - Intergenic
1181306680 22:21921131-21921153 GCGGGGAGCCAGCTTTGCTGGGG - Exonic
1181466196 22:23112017-23112039 CCAAGGCTCCAGTCTTGCTGTGG - Intronic
1181534098 22:23532948-23532970 CCAGGGGTCCAGCCTGGCTCTGG - Intergenic
1181729158 22:24832025-24832047 CCAGGGAGCCAGGATTCCGGGGG - Intronic
1182282280 22:29224530-29224552 CCAGGCAGCCAGCCTCCCTCTGG + Intronic
1182318574 22:29463848-29463870 CCAGGTCCCCAGCCCTGCTGCGG + Intergenic
1182359798 22:29739827-29739849 CCTGGGAGCCAGTGGTGCTGTGG - Intronic
1183037107 22:35148811-35148833 GCAGGAAGCCAGACCTGCTGGGG + Intergenic
1183037405 22:35150651-35150673 GCAGGAAGCCAGACCTGCTGGGG - Intergenic
1183180000 22:36253589-36253611 CCCTGGGGCCAGCCTTGGTGTGG - Intronic
1183549183 22:38471291-38471313 CCTGGGAGGCAGCCCTGGTGGGG - Intronic
1184191112 22:42895118-42895140 CCGAGCTGCCAGCCTTGCTGGGG - Intronic
1184562050 22:45269106-45269128 TGGGGGAGTCAGCCTTGCTGTGG + Intergenic
1184853964 22:47136501-47136523 CCTGGCATCCAGCCTTCCTGAGG + Intronic
1185384390 22:50525208-50525230 CGAGGGCGCTGGCCTTGCTGGGG - Intronic
1203221690 22_KI270731v1_random:48468-48490 GCATGAAGCCAGGCTTGCTGTGG + Intergenic
1203269136 22_KI270734v1_random:38352-38374 GCATGAAGCCAGGCTTGCTGTGG - Intergenic
1203281596 22_KI270734v1_random:134605-134627 CCAGGGACCCCTCCTTCCTGGGG + Intergenic
950033118 3:9864800-9864822 CCATGGAGCCAGCCTGGCACCGG + Intergenic
950184449 3:10936626-10936648 CCAAGGAGCCTGACTTGCTCTGG - Intronic
950186222 3:10947273-10947295 CCAGGAAGCCATGCTTGGTGAGG + Intergenic
950256954 3:11513430-11513452 CCAGTGGGCCAGCACTGCTGGGG + Intronic
950361186 3:12450533-12450555 CCAGGGAGGCAGCCAGCCTGTGG + Intergenic
950625850 3:14246346-14246368 CCAGGGCACCAGAGTTGCTGTGG + Intergenic
951294197 3:20913952-20913974 CCATGAAGCCAGCTTTTCTGAGG - Intergenic
954145363 3:48631750-48631772 CCACGGTGCCAACCTTGCTCTGG + Exonic
954635433 3:52068481-52068503 CCTGGCAGCCAACCTCGCTGGGG - Intergenic
955688122 3:61564436-61564458 CCAGGGAACCAGCCTTCGTGGGG + Intronic
955933450 3:64080132-64080154 CCTGGGAGCCAGCTCTGCTGGGG - Intergenic
956002606 3:64745441-64745463 GCAGGTAGCCATCCTTCCTGGGG + Intergenic
956120099 3:65957701-65957723 CCAGGGAGCGAGCCTACCCGGGG + Intronic
957777088 3:84767344-84767366 CCAAGGCCCCAGCCTTGATGAGG - Intergenic
958419881 3:93917759-93917781 CCAGTGGGCCAGCACTGCTGGGG - Intronic
958426923 3:93989456-93989478 CCAGGAAGCCTGCCATGCCGAGG - Intronic
959096398 3:101961188-101961210 CCTGGGAGTCAGCCCTGCTGAGG - Intergenic
959169866 3:102831173-102831195 CCAGGGTGACAGCCTTCCTGTGG - Intergenic
960487318 3:118269830-118269852 CCAGTGGGCCAGCACTGCTGGGG - Intergenic
960570867 3:119184023-119184045 CCAGGGAGGCAGCCCAGCTGTGG - Intronic
960712278 3:120543834-120543856 CCAAGGTCCCAGCCTTGATGAGG + Intergenic
960761666 3:121078741-121078763 CCAGTGGGCCAGCACTGCTGGGG + Intronic
961112280 3:124295105-124295127 GCAGACAGCCAGCCTTGCAGGGG + Intronic
961481702 3:127184604-127184626 CCACGGAGCCCGGCCTGCTGTGG - Intergenic
961507378 3:127379010-127379032 CCAGGGACAGAGACTTGCTGGGG + Intergenic
961532255 3:127547018-127547040 CAAGGGAGCCACACGTGCTGGGG + Intergenic
961661438 3:128470686-128470708 CCAGGGAGCAGGCCTGGCTTGGG - Intergenic
961710493 3:128824431-128824453 CCTGGTAGCCAGCCTGGCAGTGG + Intergenic
962240541 3:133747501-133747523 CCAGTGAGTCAGCCTTGCTGTGG + Intronic
962467446 3:135673632-135673654 CCAGGGAGCAAGTTATGCTGGGG + Intergenic
963119575 3:141764740-141764762 CCAGGGAGACAGCCAAACTGAGG - Intergenic
964751868 3:160060697-160060719 CCAGTGGGCCAGCACTGCTGGGG - Intergenic
967159045 3:186718528-186718550 CCAGGAAGCCAACCTGCCTGAGG - Intronic
968520982 4:1034605-1034627 CCAGGGACCAGGCCTTGCTGGGG + Intergenic
968577761 4:1375936-1375958 CCGAGGCCCCAGCCTTGCTGTGG + Intronic
969398898 4:6940515-6940537 GCCTGGAGTCAGCCTTGCTGGGG + Intronic
969740072 4:9018117-9018139 TCATGCAGCCAGCCTGGCTGTGG + Intergenic
970408641 4:15786922-15786944 CCAGTGGGCCAGCACTGCTGGGG + Intronic
970615751 4:17766994-17767016 CCAGCGGGCCAGCACTGCTGGGG + Intronic
971866374 4:32177367-32177389 GCAAGGATCCAGCCTTGGTGAGG + Intergenic
972165257 4:36276107-36276129 CCAGGGTGACAGCAATGCTGTGG - Intergenic
972997178 4:44895311-44895333 CTAGAGAGCCAGTCTTGCAGGGG + Intergenic
975040828 4:69743297-69743319 CCAGGGTGCCCTCTTTGCTGAGG - Intronic
976193828 4:82514240-82514262 GCAGGATCCCAGCCTTGCTGTGG + Intronic
977257750 4:94758589-94758611 CCCGAGACCCAGCCTTGCCGTGG + Intronic
979934060 4:126670136-126670158 CAAGGTGGCAAGCCTTGCTGGGG + Intergenic
981454020 4:144933103-144933125 CCAGGGGGCCTGCTTTCCTGTGG + Intergenic
982127379 4:152196189-152196211 CTAGGAAGGCAGCCTTGCTGGGG - Intergenic
982198419 4:152937408-152937430 CCAGGGCGCCAGCCCCTCTGCGG - Intronic
986233316 5:5886043-5886065 CCTGGGAGCCAGCGATGCTGGGG - Intergenic
987402381 5:17491627-17491649 CCAGGGTGCCAGGCTTGTAGCGG + Intergenic
987415239 5:17655397-17655419 CCAGGGTGCCAGGCTTGTAGCGG + Intergenic
988187830 5:27889610-27889632 CGAGGCAGCAAGCCTGGCTGGGG - Intergenic
988674733 5:33420292-33420314 TCAGGGACTCAGCCCTGCTGGGG - Intergenic
990652817 5:57921896-57921918 CCAGGGAGCCAGCCCAGAAGAGG - Intergenic
991243447 5:64484719-64484741 CCAGGTGGCAAGCCTGGCTGGGG - Intergenic
994141542 5:96347142-96347164 CCAGTGTGCCAGCCCTGGTGTGG + Intergenic
994669762 5:102752239-102752261 CCAGTGGGCCAGCACTGCTGGGG - Intergenic
995305915 5:110649862-110649884 CCCAGGAGCCAGACTTCCTGTGG + Intronic
997233499 5:132259517-132259539 CCAAGGAGCCAGGATGGCTGAGG + Intronic
997558718 5:134824813-134824835 CCAAGGAGCCAGCCAGGCAGTGG - Intronic
998573957 5:143292658-143292680 CCAGGGACCCAGTCTTAGTGGGG - Intronic
999291314 5:150428235-150428257 CAAGGAGGCCAGCATTGCTGGGG + Intergenic
999600188 5:153253948-153253970 CCTGGGAGCCAGCCTGGCACTGG + Intergenic
999798319 5:155008946-155008968 CCAGGGAAGCAGCCCTGCTCTGG - Intergenic
999902086 5:156095626-156095648 CCAGGGATCCAGCCCTGGAGGGG - Intronic
1001233991 5:170014131-170014153 CCAGGAAGCCATGCTTGCTTGGG - Intronic
1002200212 5:177523854-177523876 CAAGGGAGCAGGCCTTTCTGAGG + Intronic
1002438880 5:179253705-179253727 CCAGGGTTGCAGCCTGGCTGGGG - Intronic
1003468323 6:6402913-6402935 CCAAGGAAACAACCTTGCTGTGG - Intergenic
1004608882 6:17219795-17219817 ACAAGGAGCCAGCCTTGTTCTGG + Intergenic
1004613401 6:17267344-17267366 CCATTGTGCCAGCCTTGGTGTGG - Intergenic
1005510318 6:26506689-26506711 CCAGGGAGTCAGCCTTGGGAGGG - Exonic
1005695407 6:28347287-28347309 CAAGGGAGCCAGATTGGCTGAGG - Intronic
1006629321 6:35419996-35420018 TCAGGGAGTCAACCTTTCTGAGG - Intronic
1007782033 6:44259944-44259966 CCAGGGAGCCAGGAGTCCTGGGG - Intronic
1008633170 6:53383126-53383148 CAAGGGGGCAAGCCTGGCTGGGG + Intergenic
1012357508 6:98333815-98333837 TCAGGGTGGCAGGCTTGCTGTGG - Intergenic
1013487377 6:110610124-110610146 CCATGGAGCAGGCCTCGCTGGGG + Exonic
1013799182 6:113921005-113921027 CCATGCAGCCAGCCTTGGTTCGG + Intergenic
1014739010 6:125126031-125126053 CCAGTGGGCCAGCACTGCTGGGG - Intronic
1015138928 6:129908113-129908135 TCAGGGTGCCAGCCTGGTTGGGG - Intergenic
1016079443 6:139837842-139837864 CCAGGGAGGCACCTTTCCTGAGG - Intergenic
1016104721 6:140148308-140148330 CCAGTGGGCCAGCACTGCTGGGG + Intergenic
1016894308 6:149037486-149037508 CCAGGGGTCCTGCCTGGCTGGGG - Intronic
1017019453 6:150128517-150128539 CCAGGGAGACAGCGTGGATGGGG - Intergenic
1017047010 6:150356292-150356314 CCAGTGTGACAGCCTTTCTGGGG + Intergenic
1017766783 6:157613509-157613531 CCAGGGTGTCAGCCTGCCTGGGG + Intronic
1018610229 6:165641525-165641547 TCTGAGAGCCAGCATTGCTGGGG - Intronic
1018793493 6:167168624-167168646 CCTGGGAGCCACCCCGGCTGAGG + Intronic
1018823222 6:167389754-167389776 CCTGGGAGCCACCCCGGCTGAGG - Intergenic
1019021104 6:168918432-168918454 CCATGGGCCCTGCCTTGCTGTGG + Intergenic
1019116621 6:169769357-169769379 CCAGGGAGCCAGAGAGGCTGTGG - Intronic
1019275494 7:173453-173475 GCAGGCAGCCAGCGTTCCTGAGG - Intergenic
1019850088 7:3546172-3546194 CCTGGGAGTCAGCATTTCTGTGG + Intronic
1020108831 7:5436345-5436367 CCAGGGGGCCAGATTAGCTGAGG - Intronic
1020344164 7:7145338-7145360 GCAAGGAGGCAGCCTGGCTGGGG - Intergenic
1021351093 7:19595409-19595431 TCAGGGTGCCTGCCTTCCTGAGG + Intergenic
1021761266 7:23904897-23904919 CCAGTGGGCCAGCACTGCTGGGG + Intergenic
1022797711 7:33745363-33745385 CCCGGGAGCCAGCCTAGGAGAGG + Intergenic
1022903990 7:34838137-34838159 CCAGGAAGTCAGCCTCCCTGGGG - Intronic
1023153290 7:37222451-37222473 CCAGCGGGCCAGCCGTGCAGCGG + Intronic
1023868275 7:44249240-44249262 CCAGCCAGCCAGCCATGCTTAGG - Intronic
1024035908 7:45507032-45507054 CCAGGGAGCCAGGCATCCAGGGG - Intergenic
1025149388 7:56537184-56537206 CCTGGGAACCAGCCTGGGTGGGG + Intergenic
1025639754 7:63354865-63354887 CCTGGGAACCAGCCTGGGTGGGG - Intergenic
1025642945 7:63393227-63393249 CCTGGGAACCAGCCTGGGTGGGG + Intergenic
1026910758 7:74090550-74090572 ACTGAGAGCCAGCCTGGCTGTGG - Intronic
1027192072 7:76002504-76002526 CCAGGGAGGCAGGCTAGATGGGG + Intronic
1027225425 7:76240777-76240799 TAAGGGAGCCAGACTGGCTGGGG + Intronic
1027668757 7:81071283-81071305 CCAGTGGGCCAGCACTGCTGGGG - Intergenic
1028078737 7:86548002-86548024 CCAGGTAGCAAGCCTGGCTGGGG - Intergenic
1028083105 7:86601158-86601180 CCAGGGTGCCTGCCTCCCTGTGG - Intergenic
1028142507 7:87288898-87288920 CCAGTGGGCCAGCACTGCTGGGG - Intergenic
1029075228 7:97929238-97929260 CCTGGGACCCAGCCGTGCAGGGG + Intergenic
1030292702 7:107888161-107888183 CCAGTGGGCCAGCACTGCTGGGG - Intergenic
1032457184 7:132082130-132082152 ACAGGAAGCCAGCTTTGCTTGGG - Intergenic
1032705960 7:134421630-134421652 CCAGGCAGCCAGCCTCACTGAGG + Intergenic
1033887537 7:145966977-145966999 CAAGGCAGCAAGCCTGGCTGGGG + Intergenic
1034496713 7:151427553-151427575 CCCTGGACCCAGCCTTGCTGGGG - Intergenic
1034659883 7:152759876-152759898 GCAGGGAGCCTGCCATGCTCGGG - Exonic
1034945328 7:155258238-155258260 CCAGGGAGCCGTCCCTGCAGGGG + Intergenic
1035148288 7:156842776-156842798 CCAGGCTGCCAGCACTGCTGAGG - Intronic
1036242292 8:7091140-7091162 CCTGGGACCCAGCCGTGCAGGGG - Intergenic
1036258497 8:7222872-7222894 CCTGGGACCCAGCCGTGCAGGGG + Intergenic
1036307069 8:7610508-7610530 CCTGGGACCCAGCCGTGCAGGGG - Intergenic
1036310552 8:7681468-7681490 CCTGGGACCCAGCCGTGCAGGGG + Intergenic
1036357916 8:8058495-8058517 CCTGGGACCCAGCCGTGCAGGGG - Intergenic
1036893032 8:12608451-12608473 CCTGGGACCCAGCCGTGCAGGGG + Intergenic
1036899526 8:12660290-12660312 CCTGGGACCCAGCCGTGCAGGGG + Intergenic
1036900590 8:12666437-12666459 CCTGGGACCCAGCCGTGCAGGGG + Intergenic
1037065029 8:14567013-14567035 CCGGGGAGCCGGCACTGCTGGGG - Intronic
1038498363 8:28023331-28023353 CGGGGGGGCCAGCCTTGCTGGGG + Exonic
1040027701 8:42796777-42796799 CCAGCGGGCCAGCACTGCTGGGG - Intergenic
1040383357 8:46894361-46894383 CAAGGCAGCAAGCCTGGCTGGGG + Intergenic
1040519246 8:48160686-48160708 CCAGTGAGCCAGGTTGGCTGAGG + Intergenic
1042645280 8:70979979-70980001 CGAGGCAGCAAGCCTGGCTGGGG - Intergenic
1042823333 8:72955665-72955687 CAAGGGTGCAAGCCTTTCTGTGG + Intergenic
1043089181 8:75876051-75876073 CGAGGCAGCAAGCCTGGCTGGGG - Intergenic
1045672801 8:104575345-104575367 CCAGGGTGCCTGCCTTCCTGTGG - Intronic
1048447816 8:134504991-134505013 CCAGGGACCCAGGAGTGCTGTGG - Intronic
1048534136 8:135276646-135276668 CCTGTGAGCCATCCTAGCTGAGG + Intergenic
1048857084 8:138694782-138694804 CCAGGTAACCAGCCCTGCGGGGG + Intronic
1049322818 8:142006054-142006076 ACAGGGCACCAGCCTTGTTGGGG - Intergenic
1049418793 8:142507682-142507704 GCAGGGAGCCGGGCTGGCTGGGG - Intronic
1049421446 8:142518378-142518400 CCACGGAACCAGCCATGCTGTGG + Intronic
1049690752 8:143957829-143957851 CCTGGCAGCCTGCCCTGCTGGGG + Intronic
1049818300 8:144618767-144618789 CCTGGGAGCAAGTCCTGCTGGGG + Intergenic
1050604157 9:7283430-7283452 CGAGGCAGCAAGCCTGGCTGAGG - Intergenic
1055585395 9:77754099-77754121 CCAGGGTGCCATCCACGCTGAGG - Intronic
1055766730 9:79671713-79671735 GCAGTGAGTCAGCCTTGCTATGG + Intronic
1055861183 9:80751129-80751151 GCTGGGAGCCAGCTTTGCTCTGG + Intergenic
1056805935 9:89728928-89728950 CCAGGGACAAAGCTTTGCTGTGG - Intergenic
1056825102 9:89871881-89871903 CCAGGTAGCCAGCCCTAGTGTGG - Intergenic
1057178468 9:93016198-93016220 GCAGGGAGCAATCCTGGCTGGGG + Intronic
1057383915 9:94591331-94591353 CCAGTGGGCCAGCACTGCTGGGG + Intronic
1057543855 9:96001906-96001928 CCAGTGGGCCAGCACTGCTGGGG + Intronic
1058135187 9:101299409-101299431 CCAGGGAGCAACCTTTGCTTGGG + Intronic
1058365190 9:104200768-104200790 CCAGTGAGCCAGCACTGCTGGGG - Intergenic
1059322923 9:113483290-113483312 CCAGGGACCCAGCCGAGCTAAGG - Intronic
1059510034 9:114836412-114836434 ACAGGTATCCTGCCTTGCTGGGG + Intergenic
1060171981 9:121469368-121469390 CCTTGGATCCAGCCATGCTGAGG - Intergenic
1060959274 9:127667926-127667948 CCTGTCAGCCAGGCTTGCTGTGG - Intronic
1061074689 9:128333939-128333961 CCAGCCAGCCAGGTTTGCTGGGG + Exonic
1061111726 9:128577081-128577103 CTAGGGAGTCATCATTGCTGTGG + Intronic
1061702268 9:132424776-132424798 CCAGGGAGCCAGGATGGCTGGGG + Intronic
1061906837 9:133703337-133703359 CCAGGGAGCAGCCCTGGCTGAGG - Intronic
1061939485 9:133876417-133876439 CCAGGGGGCCTGCCTTCCTTAGG - Intronic
1062042856 9:134412093-134412115 TCGGGGAGCCTGCCTTGCAGTGG - Intronic
1062044862 9:134420286-134420308 CTAAGAAGCCAGCCTGGCTGTGG + Intronic
1062049770 9:134441207-134441229 CCCGGGAGCCACCCTAGCTCTGG - Intergenic
1062140798 9:134957777-134957799 ACAGGGAGACTGCCTTGCAGAGG - Intergenic
1062253623 9:135610747-135610769 CAAGGGAGGCAGCCTCCCTGTGG + Intergenic
1062346178 9:136116290-136116312 CCAGGAAGCCAGCCTAGGGGTGG + Exonic
1062407578 9:136404125-136404147 CCAGGGTGCCAGCCTGACCGTGG - Exonic
1062503040 9:136859355-136859377 CCAAGGGGCCAGCCTGGCTCGGG + Intronic
1062676188 9:137745870-137745892 CCAAGAAGGCAGCCCTGCTGGGG - Intronic
1062682729 9:137790937-137790959 CCAGGGCCCCAGCCTTGATGAGG - Exonic
1185803350 X:3033305-3033327 CCATGGCTGCAGCCTTGCTGTGG + Exonic
1190148161 X:47917598-47917620 GTGGTGAGCCAGCCTTGCTGAGG + Exonic
1190263603 X:48814889-48814911 CCAGGGAGCCTGCCTTACCTTGG - Exonic
1192174618 X:68878033-68878055 CCAGGTAGGCAGACTGGCTGAGG + Intergenic
1194384387 X:93235904-93235926 CCAGGGGGCCTGCACTGCTGGGG - Intergenic
1198694452 X:139320975-139320997 CCAGTGGGCCAGCACTGCTGGGG - Intergenic
1199609540 X:149600968-149600990 CCAGGCAGCCAGACTTTCTGGGG - Intronic
1199629576 X:149768386-149768408 CCAGGCAGCCAGACTTTCTGGGG + Intergenic
1200250662 X:154552203-154552225 CAGGGGATCCAGCCCTGCTGAGG + Intronic
1201495687 Y:14589971-14589993 CCAGTGGGCCAGCACTGCTGGGG + Intronic
1202190514 Y:22238678-22238700 CCAGGGAGCCAGCCTGTCAGTGG - Intergenic
1202235762 Y:22708683-22708705 CCGGTGAGCCAGCCCGGCTGGGG - Intergenic
1202272656 Y:23085948-23085970 CCAGTGGGCCAGCCGTGCTGGGG + Intergenic
1202293370 Y:23334734-23334756 CCAGTGGGCCAGCCGTGCTGGGG - Intergenic
1202307401 Y:23487485-23487507 CCGGTGAGCCAGCCCGGCTGGGG + Intergenic
1202425653 Y:24719692-24719714 CCAGTGGGCCAGCCGTGCTGGGG + Intergenic
1202445136 Y:24950393-24950415 CCAGTGGGCCAGCCGTGCTGGGG - Intergenic
1202563404 Y:26183101-26183123 CCGGTGAGCCAGCCCGGCTGGGG - Intergenic