ID: 1067724905

View in Genome Browser
Species Human (GRCh38)
Location 10:48762632-48762654
Sequence CTGGCAAAGGGTTCCTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067724894_1067724905 22 Left 1067724894 10:48762587-48762609 CCAGGATGACCTCTTTAGCTGTG 0: 1
1: 0
2: 1
3: 12
4: 125
Right 1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG No data
1067724899_1067724905 -4 Left 1067724899 10:48762613-48762635 CCTCAGCAAGGCTGGCTCCCTGG 0: 1
1: 0
2: 4
3: 52
4: 451
Right 1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG No data
1067724893_1067724905 23 Left 1067724893 10:48762586-48762608 CCCAGGATGACCTCTTTAGCTGT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG No data
1067724896_1067724905 13 Left 1067724896 10:48762596-48762618 CCTCTTTAGCTGTGGCACCTCAG 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG No data
1067724892_1067724905 26 Left 1067724892 10:48762583-48762605 CCTCCCAGGATGACCTCTTTAGC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1067724905 10:48762632-48762654 CTGGCAAAGGGTTCCTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067724905 Original CRISPR CTGGCAAAGGGTTCCTAAGC TGG Intronic
No off target data available for this crispr