ID: 1067726244

View in Genome Browser
Species Human (GRCh38)
Location 10:48773442-48773464
Sequence TCCTTCCCAGGCTGGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067726244 Original CRISPR TCCTTCCCAGGCTGGATAAA GGG (reversed) Intronic
900117625 1:1035196-1035218 CCCTTTCCAGGCTGGGCAAAGGG + Intronic
900195611 1:1374228-1374250 TCCTGCCCAGACTGGATACCGGG - Exonic
901208917 1:7513477-7513499 TCCTTCCGAGGCTGGAAGAGAGG + Intronic
901316945 1:8315972-8315994 TCCTGCCCAGGCTGAAGAGAAGG - Intergenic
904849296 1:33445268-33445290 TCCTCCGCAGGCTGGATGCACGG + Intergenic
905632536 1:39526683-39526705 TCTTTCCCAGGCAGGAGAAGGGG - Intergenic
907249872 1:53130894-53130916 TCCTGGCCAGGATGGATAATAGG + Intronic
907486594 1:54782253-54782275 TCCTTGCCAGGCTAGACCAAGGG - Intronic
908026953 1:59962358-59962380 TTCTTCTCAGGCTGGCTACATGG - Intergenic
908772652 1:67610400-67610422 TCCATGCCAGGCTGGAGCAAGGG - Intergenic
909312868 1:74175480-74175502 TCCTTCCCCCACTGGATAAATGG + Intronic
918177745 1:182060314-182060336 GCCATCTCAGACTGGATAAAAGG + Intronic
919844552 1:201633439-201633461 TCCATCCCAGGCTTGTCAAAAGG + Intronic
920940641 1:210478797-210478819 TCCATCTAAGACTGGATAAATGG - Intronic
921497299 1:215857424-215857446 TGCTTCCCAGGCTGTCTGAATGG - Intronic
922684162 1:227626388-227626410 TCCTTCCCAGGATGTATCCAGGG + Intronic
922961356 1:229648588-229648610 TCCTTCACAGGCTTGCTATAGGG - Intronic
923629422 1:235640134-235640156 TCCTCCCCAGGCTGAATGCATGG - Intronic
1063348263 10:5331538-5331560 GCCTTCCCTGTTTGGATAAATGG - Intergenic
1065375103 10:25031645-25031667 TCCCTCCCAGAAAGGATAAATGG - Intronic
1066327870 10:34383532-34383554 TGCTTCCCAGGCTGGTTGTATGG - Intronic
1067726244 10:48773442-48773464 TCCTTCCCAGGCTGGATAAAGGG - Intronic
1068984312 10:63092939-63092961 TCCAGCCTAGGCTGGACAAAGGG + Intergenic
1069546916 10:69335296-69335318 TCCTTCCCAGACTGTGTGAAAGG + Intronic
1070144916 10:73766821-73766843 TCCATTCCAGCCTGGATAACTGG - Exonic
1070946013 10:80392291-80392313 TGTTGCCCAGGCTGGATGAAGGG - Intergenic
1072619671 10:97071386-97071408 TCCTTCCCAGGCTTGGCCAAAGG - Intronic
1074774161 10:116754144-116754166 TCCTTCCCAGGCTGGCAATGTGG + Intergenic
1074871349 10:117578495-117578517 ACCCTGCCAGGCTGGAAAAACGG + Intergenic
1075177847 10:120182468-120182490 TCCTTCCCAGGATTGTTAGAGGG - Intergenic
1078067645 11:8088883-8088905 TCCTTCCCGGGCTGCAGACATGG - Intronic
1078855854 11:15206158-15206180 TGCTTCCCAGGATGGCTGAAGGG + Intronic
1079148366 11:17874830-17874852 TCTTTCCCAGCCTGGATATCAGG - Intronic
1079933434 11:26591943-26591965 TCCTTCCCAGGATGTATCTAGGG + Intronic
1081430257 11:42968895-42968917 GCCTTCCAAGTCTGGAAAAATGG + Intergenic
1085455323 11:76662184-76662206 TTCTTCCCAGGCTGGGTCAGGGG + Intronic
1085959152 11:81439063-81439085 TTCTTTGCAGGCTGGAGAAAGGG - Intergenic
1087175607 11:95092349-95092371 TCCTTCCCTAGCTGCATAAATGG - Intronic
1087379341 11:97384958-97384980 TGCTTCCCAGGAAGGAAAAAGGG - Intergenic
1087696817 11:101388358-101388380 CAATTCCCAAGCTGGATAAAAGG - Intergenic
1089730891 11:120518045-120518067 GCCTCCCCAGGCTGGAGAACAGG - Intronic
1091230648 11:133985964-133985986 TCCTTCCCAGGCTTGCTATCAGG + Intergenic
1096610837 12:52800446-52800468 TCCTCCCCAGGCAGGATTGATGG - Intergenic
1096817176 12:54208885-54208907 TCCCTCCCAGGCTCGATGTAAGG - Intergenic
1098237274 12:68429402-68429424 TCCTTCCAGGCCTGGATAAATGG - Intergenic
1099490010 12:83276685-83276707 TGCTTCCCAGTCTGCATACACGG + Intergenic
1099620824 12:85000951-85000973 TGCTTCCCAGGCTGTGAAAATGG + Intergenic
1101207402 12:102502301-102502323 TCCTTCCCAGGTTTGCTAAAGGG - Intergenic
1102774825 12:115509273-115509295 TCCTTACCAGCCAGGAAAAATGG + Intergenic
1102998893 12:117370137-117370159 TCGTTGTCTGGCTGGATAAATGG - Intronic
1103679892 12:122685131-122685153 TATTGCCCAGGCTGGAAAAAAGG - Intergenic
1107137236 13:36957896-36957918 TCCTTCCCAGGATGTATCTAGGG - Intronic
1110816215 13:79862694-79862716 TGCTTCCCAGGGTGGCTATAAGG + Intergenic
1112177080 13:97036493-97036515 TGTTTCCCAGGCTGGAGAAGTGG - Intergenic
1114241249 14:20870444-20870466 TCTTTCCCAGATTTGATAAATGG - Intergenic
1115076725 14:29401636-29401658 AACTTCCCAGACTCGATAAATGG - Intergenic
1116446941 14:45021710-45021732 TCCTTCCCAGGATGTATCTAGGG + Intronic
1116606325 14:47001158-47001180 TCCTAACCTGGCTGCATAAATGG - Intronic
1119474140 14:74917510-74917532 TCTTTACCAAGCTGGCTAAATGG - Intronic
1121010035 14:90514412-90514434 TCCATGCCAGGCTGGGGAAATGG + Intergenic
1123150555 14:106177496-106177518 TCTTTCTCATGCTGGATCAAGGG - Intergenic
1126566799 15:50109114-50109136 TTCTTCCCAGGCTGAAGATAAGG - Intronic
1129940664 15:79494274-79494296 TCCTTCCCAGGCTTCACACATGG - Intergenic
1131195988 15:90355339-90355361 TCCAACCCAGGCTGGAAAAGGGG - Intronic
1131973475 15:97916798-97916820 TCATACCCAGGCTTGATAGAAGG - Intergenic
1132341355 15:101080206-101080228 CCCTTCCCAGGCAGGAAAGAGGG - Intergenic
1133389628 16:5399188-5399210 TCCCTCCCTCGCTTGATAAATGG + Intergenic
1136288526 16:29258176-29258198 CCCTTCCCGGGCTGGAGAGATGG + Intergenic
1136405058 16:30040503-30040525 GCCTTCCAAGTCTGGAGAAAAGG + Intronic
1138220114 16:55243044-55243066 TCCTTCCCCAGCTTGATCAATGG - Intergenic
1138536173 16:57661384-57661406 TCCTTCCCAGGCTGGAGCTCAGG - Intronic
1138599431 16:58046104-58046126 TCCTTCCCTCTCTGGAGAAAGGG + Exonic
1139060528 16:63245304-63245326 TCCTTCCCATGTTAGAGAAATGG + Intergenic
1142094241 16:88231082-88231104 CCCTTCCCGGGCTGGAGAGACGG + Intergenic
1142609911 17:1103371-1103393 TGCTTCCCAGCCTTGACAAATGG + Intronic
1142681333 17:1550731-1550753 TGTTGCCCAGGCTGGCTAAAAGG + Intronic
1146459121 17:33030589-33030611 TCCTTCCTAAGATGGAAAAAGGG - Intronic
1146997577 17:37334434-37334456 TCCTTCCCAGGATGTATCTAGGG - Intronic
1147162879 17:38578290-38578312 TCCTCCCCAGGCTCCAGAAAAGG + Intronic
1148449799 17:47769343-47769365 ACCTTCCCAGGATGGAAAGAGGG - Intergenic
1149080336 17:52648729-52648751 TCCTTCCCAGGGTGGTTATGAGG - Intergenic
1150306792 17:64092208-64092230 TCCTTCCCAGTCTGCATGACAGG + Intronic
1152820965 17:82437446-82437468 GCCTTCCCAGGTTGGTCAAAGGG + Intronic
1153504763 18:5785599-5785621 TCCTTCCCAGTGTGGCTAAAAGG + Intergenic
1157071325 18:44412195-44412217 TCCATCCCAGGCAAGAAAAAGGG + Intergenic
1157364886 18:47055445-47055467 TCCTTCTGAGGCTGGAACAAGGG - Intronic
1157594272 18:48854378-48854400 TTCTTCCCATGCAGGTTAAAGGG - Intronic
1158098502 18:53803099-53803121 TGCTTGCCAAGCTAGATAAAAGG - Intergenic
1161350890 19:3790916-3790938 TCCTTCTCAGGCAGGCTAATGGG - Intronic
1161956323 19:7497555-7497577 TCCTTCCCAGGCTGCATCCAAGG - Exonic
1163572973 19:18093706-18093728 TCCACCCCAGGCTGGACTAAGGG + Intronic
1163662100 19:18584461-18584483 TCCTTCCCACGATGGATCTAGGG - Intronic
1167512670 19:49904277-49904299 TCCTTCCCAGTCCTGACAAATGG - Exonic
1167602849 19:50464718-50464740 TCCTTCCCAAGCTGGGTCAGGGG - Intronic
1168592880 19:57651688-57651710 TGCTTCCCAGGTTGCAAAAAGGG - Intergenic
928134934 2:28681055-28681077 TTCTTTCCAGGCCGGATGAATGG + Intergenic
928370842 2:30739206-30739228 CCCTTCCCAGGCTGGACATGAGG - Intronic
929771301 2:44894501-44894523 CCCTTCCCAGGCTGGATTCCAGG - Intergenic
932606780 2:73170586-73170608 TCCTGCCCAGGCTGCAGAAGGGG - Intergenic
933925648 2:87089856-87089878 TCCTGCCCAGGCTGCAGAAGGGG + Intergenic
936444233 2:112583989-112584011 TGGGTCCCAGGCTGGGTAAATGG + Intergenic
936817220 2:116474012-116474034 TCCTTCCCATGCTGCAAAACTGG - Intergenic
938902576 2:135810421-135810443 TCCTCCTCAGAATGGATAAAAGG + Intronic
939588779 2:144037438-144037460 TCCTCCCAAGTCTGGATACAAGG - Intronic
940140691 2:150487758-150487780 TCGCTCCCAGGCTCCATAAAAGG - Intronic
940545183 2:155073928-155073950 TACTTCCAAGTATGGATAAATGG + Intergenic
942193659 2:173495938-173495960 TCCTGGAAAGGCTGGATAAATGG + Intergenic
942897611 2:181076424-181076446 TCCTTCCCAGGTTCCCTAAAGGG + Intronic
944339583 2:198580354-198580376 TTCTGCCCAGGCAGGAAAAATGG + Intergenic
944347463 2:198685491-198685513 TGTTTCCCAGTCTGGATACATGG - Intergenic
944899228 2:204197170-204197192 TCCCTCCCAGCCTGGGAAAATGG - Intergenic
945054287 2:205854714-205854736 CTCTTCCCAGGCTGGATAAATGG - Intergenic
946645538 2:221829486-221829508 ACCTTCCCAGGCTGGCTGCAAGG + Intergenic
948233741 2:236371131-236371153 TCCTGCCCTGCCTGGATGAAGGG + Intronic
948316014 2:237029068-237029090 TCCTTCAAAGGCTGCAGAAACGG - Intergenic
1170868520 20:20182949-20182971 TCCTTCCTTTTCTGGATAAAGGG - Intronic
1170987160 20:21268974-21268996 ACCATGCCAGGCTGGATACATGG + Intergenic
1171498423 20:25574511-25574533 TCCTTCCCTTTCTGGGTAAAGGG - Intronic
1171516668 20:25743804-25743826 TCCTTCCCAGCCTAGAGAATAGG - Intergenic
1172011018 20:31845613-31845635 GCCTGCCCAGGCTGGTTAAAAGG + Exonic
1174378117 20:50139575-50139597 TCCTCCCCAGCCTGGAAACACGG + Intronic
1175647567 20:60687808-60687830 AGCCTCCCAGGCTGGATAAATGG - Intergenic
1175707410 20:61190804-61190826 TCCTTCCTAGGCTGGCTTGAGGG + Intergenic
1178316121 21:31568162-31568184 TACTGCCCAGGCTGGAAGAATGG + Intergenic
1178683923 21:34696477-34696499 TCATTCCCACCCTGGACAAATGG - Intronic
1179525120 21:41971080-41971102 TCTATTCCATGCTGGATAAAAGG + Intergenic
1181627511 22:24131692-24131714 ACCTTCTCAGACTGGGTAAAAGG + Intronic
1183311035 22:37109591-37109613 GCCAGCCCAGGCTGGATCAATGG + Intergenic
1183429172 22:37755443-37755465 TCCTTCCCAGGATGCATCTAAGG - Intronic
1183632668 22:39042780-39042802 TCCTTCCCAGGCAGGAAGACCGG - Intronic
953348869 3:42199366-42199388 TCCTTCCCAGTCCAGATTAAGGG + Intronic
953385764 3:42504859-42504881 TCCTTCCCAGGCTGAAGTCAGGG - Intronic
953773648 3:45797475-45797497 TCCTTGCCAGGCAGGAGAGAGGG - Intergenic
954003416 3:47575350-47575372 TCCTTTACAGGCTGTAGAAATGG - Intronic
954637533 3:52079369-52079391 TCCTCACCAGGCTGGAGACAAGG + Intronic
955978579 3:64501536-64501558 TGCTTACCAGGCAAGATAAAGGG + Intergenic
959497362 3:107067109-107067131 TCTTTCCCAGAGTGTATAAAAGG + Intergenic
961008820 3:123422961-123422983 TCCTTCCCAGGAGGGAAACAGGG - Intronic
961147764 3:124609594-124609616 TCCTTCCCAGGCAGCAACAAAGG - Intronic
962042231 3:131719357-131719379 TCCTTCCCAGGCTGTCAAGAGGG + Intronic
962920300 3:139944284-139944306 TGCATCCAGGGCTGGATAAAAGG - Intronic
963102469 3:141620458-141620480 GCCTTCCCAGGCTCTGTAAATGG - Intergenic
963908528 3:150794669-150794691 TTCTTCCCACTCTGGATAACAGG + Intergenic
965602745 3:170471068-170471090 CCCTTCCCAGACAGGTTAAAGGG - Intronic
965934960 3:174097050-174097072 TCGTTCCCAAGGTGAATAAATGG - Intronic
976338291 4:83916444-83916466 TCATTCCCACTCTAGATAAATGG + Intergenic
978815214 4:112896788-112896810 TGGTTCCAAGGCTGAATAAAGGG - Intronic
980872284 4:138624427-138624449 TCCTTCCCAGGATGTATCTAGGG + Intergenic
983081147 4:163387047-163387069 TCCTTCCCAGGCTGGAAACCTGG + Intergenic
983100592 4:163621782-163621804 TTCAACCCAGGGTGGATAAATGG - Intronic
983181660 4:164655936-164655958 TCCTTCCCAGGATGTATGTAGGG - Intergenic
983915032 4:173282624-173282646 TCCTCCCGAGGCTGGTTTAAGGG + Intronic
984037678 4:174690899-174690921 TCCATGACAAGCTGGATAAAGGG - Intronic
986480960 5:8187578-8187600 TCCTTCTCAGGCGGAATAGATGG + Intergenic
987802318 5:22714946-22714968 TCTTTCCCAGGCTGGAATACTGG + Intronic
988195058 5:27994129-27994151 AGCTTCCCAGGCTGGGTAGAGGG + Intergenic
990187073 5:53220777-53220799 TCCTTCCCACGATGGATCCAGGG + Intergenic
991170500 5:63619555-63619577 TGTTGCCCAGGCTGGAGAAATGG + Intergenic
994690071 5:103006833-103006855 TCCTTCCCAGGATTAATACAGGG - Exonic
995125894 5:108576779-108576801 TCCTTCCCAGGATGTATCTAGGG + Intergenic
995444988 5:112232619-112232641 TTCTTCACAGGCTTGACAAAAGG + Intronic
996913487 5:128682188-128682210 CCCTTCCCAGGCTGGGTGAGTGG - Intronic
1001980395 5:176034095-176034117 CCCTTCCCATGCAAGATAAAGGG - Intronic
1002237066 5:177809970-177809992 CCCTTCCCATGCAAGATAAAGGG + Intergenic
1002868714 6:1147040-1147062 TCCTTTCCAGTCAGGAGAAACGG - Intergenic
1003216551 6:4118630-4118652 TCTCTCCCAGGCTGGTTAAGTGG - Intronic
1005008401 6:21312763-21312785 TCCTTCCAAGGAGGGAGAAAAGG - Intergenic
1010702304 6:79064986-79065008 GGCTTCCAAGGTTGGATAAATGG - Intronic
1011189257 6:84713201-84713223 TCCTTCCCAGGATGTATCTAGGG + Intronic
1013889129 6:115005084-115005106 CCCTTCCCAGGGCAGATAAAGGG - Intergenic
1015062604 6:128984844-128984866 TGATTCCCAGGGTGGATACATGG - Intronic
1021737140 7:23650873-23650895 TCATTCCCAGGGTAGGTAAAAGG + Intergenic
1023940455 7:44765816-44765838 TCCTTCCCCGTTTGGATTAAGGG + Intronic
1024768275 7:52687060-52687082 TACTTCCCAGGCTGGAATATGGG + Intergenic
1024774069 7:52761927-52761949 TCCTTCCCAGGCTGTAGCATAGG - Intergenic
1026909644 7:74084379-74084401 TTCTTCCGAGACTGGATAAAGGG - Intronic
1028588051 7:92470592-92470614 TCCTTCCCAGGATGTATCTAGGG + Exonic
1030485373 7:110159570-110159592 TAATTCCACGGCTGGATAAAAGG + Intergenic
1033562141 7:142542387-142542409 TCCTTCCCTTTCTGGGTAAAGGG + Intergenic
1034720534 7:153288297-153288319 TGCTTCCCTGGCTGTATTAAGGG + Intergenic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1035043054 7:155944893-155944915 TCCTTCCGAGGCAGGAGAATAGG + Intergenic
1035078458 7:156197046-156197068 TCCTTCCCTGGCTGGGAAAATGG - Intergenic
1035225681 7:157430903-157430925 ACCTTCCCAGGATGGAGAGAAGG + Intergenic
1038162825 8:25056353-25056375 TCCTTCCCAGGCTGGGACAGTGG + Intergenic
1041650033 8:60293272-60293294 TGCTTTCCAGACTGGATGAATGG - Intergenic
1050749319 9:8918646-8918668 TCCTTCTCTGGATGCATAAAAGG + Intronic
1051698887 9:19797803-19797825 CCCTTCCCACGCTGGCAAAAAGG - Intergenic
1055915881 9:81399764-81399786 TCTTTCCCAGTCTGGAAAATGGG - Intergenic
1056937260 9:90925458-90925480 TTCTTCAGAGGCTGGATACATGG - Intergenic
1057250556 9:93497825-93497847 GCTTTTCCAGGCTGAATAAAAGG + Intronic
1057490094 9:95513823-95513845 CCCTCCCCAGGCTGGAGGAAAGG + Intronic
1061058885 9:128240577-128240599 TCCTTCCCAGGCCCCATAAGGGG + Intronic
1062338570 9:136083341-136083363 TCCTTCCCAGGCTGGGTTGGGGG + Intronic
1062571375 9:137187158-137187180 TCCTCCCCAGGATCGACAAAAGG + Intronic
1187981806 X:24765202-24765224 TCCTTCCCAGGCTTGGTGCAGGG + Intronic
1189946832 X:46188485-46188507 TCCTTCCCAGGATGTATCTAGGG - Intergenic
1191158651 X:57303112-57303134 TCTTTCCAAGGATGGAGAAAAGG - Intronic
1195590290 X:106617060-106617082 TGTTTCCCAGGCTGGATCACTGG + Intronic
1197954282 X:131929958-131929980 TCCTTCCCAGGATGTATCTAAGG + Intergenic
1198871518 X:141180714-141180736 TGCTTCCCTGGTTGGAGAAAGGG + Intergenic