ID: 1067726329

View in Genome Browser
Species Human (GRCh38)
Location 10:48773990-48774012
Sequence CTCTGTGGGGGGAAGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 2, 2: 5, 3: 48, 4: 674}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067726329_1067726338 -7 Left 1067726329 10:48773990-48774012 CCAGCCACCTTCCCCCCACAGAG 0: 1
1: 2
2: 5
3: 48
4: 674
Right 1067726338 10:48774006-48774028 CACAGAGGTGCAAGCCAGCATGG No data
1067726329_1067726341 20 Left 1067726329 10:48773990-48774012 CCAGCCACCTTCCCCCCACAGAG 0: 1
1: 2
2: 5
3: 48
4: 674
Right 1067726341 10:48774033-48774055 ATCGTCCCATCTTTTGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067726329 Original CRISPR CTCTGTGGGGGGAAGGTGGC TGG (reversed) Intronic
900456749 1:2778617-2778639 CTCTGTGGGGGGAGACAGGCAGG + Intronic
900525533 1:3126603-3126625 CTCTGTGGTGGGCAGAGGGCTGG + Intronic
900931836 1:5742824-5742846 CGCTGTGGGGAGAAGGGGACTGG - Intergenic
901685406 1:10940903-10940925 CCCCGTGGGGAGAAGGTGGGTGG - Intergenic
902234898 1:15050962-15050984 CTCCTTGGGGGGAAGCCGGCTGG - Intronic
902421405 1:16283378-16283400 TTCTGTGGGGAGAATGTGGTGGG + Intronic
902447860 1:16478470-16478492 CTCTCTGCAGGGAAGGTGGCTGG + Intergenic
902467764 1:16628694-16628716 CTCTCTCCAGGGAAGGTGGCTGG + Intergenic
902506813 1:16944034-16944056 CTCTCTGCAGGGAAGGTGGCTGG - Intronic
902619871 1:17644527-17644549 CTCTGTAGGGGACAGGTGGTTGG + Intronic
902664145 1:17925849-17925871 CTCTGTGGGGAGAAGACGGAGGG - Intergenic
902968581 1:20030226-20030248 CTCGGTGAGGGGGATGTGGCAGG + Intronic
903163735 1:21507103-21507125 GTTTGAGGGTGGAAGGTGGCAGG + Intergenic
903314285 1:22489054-22489076 CTGTGAGGTGGGAAAGTGGCAGG + Intronic
903460968 1:23520882-23520904 CTTGGTTGGGGGAAGGTGTCAGG - Intronic
903896373 1:26608287-26608309 CTTTGTGGGGCCAAGGTGGGAGG - Intergenic
904160565 1:28519330-28519352 CTCTGCGGGGTGGAGGAGGCAGG + Intronic
904214611 1:28909550-28909572 CTCTGTGAGGCCAAGGTGGGAGG + Intronic
904278060 1:29397050-29397072 CTCAGTGGAGGGAAGGTGTGGGG - Intergenic
904367907 1:30028388-30028410 CTGTGTGGTGGGAAGGTCACTGG - Intergenic
904492433 1:30869373-30869395 CTTTGATGGGGGAAGATGGCTGG + Intergenic
904749525 1:32732833-32732855 CTTTGTGGGGCGGAGGTGGGTGG - Intergenic
905628482 1:39504794-39504816 CTCGGTGAGGGGGATGTGGCAGG + Intronic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
906210964 1:44011917-44011939 CACTGTGGGAGGGAGGTGGAAGG - Intronic
906508323 1:46396062-46396084 CTCGGTGAGGGGGATGTGGCAGG + Intronic
907071742 1:51541788-51541810 CTCTCTGGGAGGAAGGTCTCAGG + Intergenic
907719966 1:56962739-56962761 CCCTCTGGGGGTAAGGTGGGGGG - Intronic
907806896 1:57829720-57829742 ATCTCTGGGTGGAAGGGGGCGGG - Intronic
909347859 1:74613748-74613770 GTCTGTGGGGATAGGGTGGCAGG - Intronic
909488532 1:76200848-76200870 CTCAGTGGTGGTAAGGAGGCAGG + Intronic
909657566 1:78047570-78047592 CTCTAGGGGAGGCAGGTGGCAGG + Intronic
911111924 1:94198230-94198252 CTCTGGGGGGCCAAGGTGGGTGG + Intronic
911633314 1:100206838-100206860 CTCTGGGAGGCCAAGGTGGCTGG + Intronic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
913189899 1:116404603-116404625 CTCTATGGGGGGAGGGGGGAGGG + Exonic
913195776 1:116454886-116454908 CTCTGAGGAGGGAAGGGGGCAGG - Intergenic
915014875 1:152723735-152723757 CTCTGTTGGGGGGAGGGGGAGGG + Intergenic
915111206 1:153565679-153565701 CTCTCTGGGAGGGAGGGGGCTGG - Exonic
915405594 1:155657525-155657547 CACTGTGAGGGGAACTTGGCAGG + Intergenic
915428282 1:155845107-155845129 CTCTGTGGGGGGAGTGAGGTAGG + Intronic
915609200 1:156977655-156977677 CTTTGTGGGGCTAAGGTGGGAGG - Intronic
915624849 1:157108099-157108121 CTCTTTGGGGGTGAGGTGGGAGG + Intergenic
916243254 1:162660683-162660705 CTCTCAGGAGGGAAGGTGTCCGG - Intronic
916244670 1:162675385-162675407 TTCTGTGAGGGGACGATGGCGGG + Intronic
917012213 1:170487682-170487704 CTCTGTGCAGGGAAGGTGAGAGG + Intergenic
917218126 1:172699075-172699097 CCCAGATGGGGGAAGGTGGCAGG + Intergenic
917291317 1:173475194-173475216 CTCGGTGAGGGGGATGTGGCAGG - Intergenic
917511248 1:175670941-175670963 CTCTGTGGGGGGTAGGTTGGAGG + Intronic
918165429 1:181941537-181941559 CACTTTGGGAGGAAGGTGGGTGG - Intergenic
918336537 1:183520599-183520621 CTCTGTTGGGGGGAGGGGGAAGG + Intronic
918412793 1:184277673-184277695 CTCTGTGTGTGGAAGGGGACAGG + Intergenic
918419279 1:184346814-184346836 TTGGGTGGGGGGAGGGTGGCAGG - Intergenic
918513059 1:185332531-185332553 CTATTTGGGGGGCAGGGGGCTGG + Intergenic
919837100 1:201582568-201582590 CTCTGTGTGGGGGAGCTGGCTGG - Intergenic
919856264 1:201708406-201708428 GTTTGAGGGGGGAAGGGGGCAGG - Intronic
919935018 1:202245598-202245620 CTCTGTGGGGCGCAGAGGGCAGG - Intronic
920787664 1:209057925-209057947 ATCTGAGGGTGGAAGGTGGGCGG + Intergenic
921574740 1:216821440-216821462 CTTTGTGGGGCCAAGGTGGGAGG + Intronic
921682532 1:218051364-218051386 CTTTGTGGGGTGGAGGTGGGAGG - Intergenic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922271135 1:224035824-224035846 CTCTGTGGAGACAAGGTGGTTGG + Intergenic
922695432 1:227728756-227728778 CGCTGTGGCGGGAAGATGGCCGG + Intronic
923109072 1:230876624-230876646 CTCTGTGGTGCGCAGGTGGGTGG - Intergenic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
924152216 1:241141000-241141022 CTGTTTGGGGTGAAGGTGGTGGG - Intronic
924444554 1:244117007-244117029 GCCTGTGGAGGGAATGTGGCTGG + Intergenic
1062867207 10:865785-865807 CACTGTGGTGTGAAGGTGGGTGG - Intronic
1063918016 10:10904011-10904033 CTCTGTAGAGAGAAGATGGCAGG - Intergenic
1064227823 10:13503176-13503198 CAATGAGGGAGGAAGGTGGCAGG + Intronic
1065668956 10:28092874-28092896 GTCTGTGATAGGAAGGTGGCTGG - Intronic
1066168051 10:32808929-32808951 CTTTGGGAGGTGAAGGTGGCAGG + Intronic
1066420025 10:35256488-35256510 CTCTGGGGGGTCAAGGTGGCTGG + Intronic
1066482381 10:35809468-35809490 CCCTGAGGTGGGAAGGAGGCTGG - Intergenic
1066656778 10:37704314-37704336 GTCTGAGGGAGGGAGGTGGCAGG + Intergenic
1066674922 10:37877758-37877780 CTTTGTGGGGCAAAGGTGGGAGG + Intergenic
1067726329 10:48773990-48774012 CTCTGTGGGGGGAAGGTGGCTGG - Intronic
1068080563 10:52313786-52313808 CTCTGAGAGGGCCAGGTGGCGGG - Intergenic
1068668364 10:59699258-59699280 CTCAGTGTGGGAAAGGTAGCAGG + Intronic
1069450009 10:68509469-68509491 CTTTGTGGGGCCAAGGTGGGAGG + Intronic
1069554589 10:69389463-69389485 CTCTGGCGGGGGGAGGTGGGGGG + Intronic
1069613197 10:69789163-69789185 CTCTGTGTGGGGAAGGCTGTGGG + Intergenic
1069833638 10:71295725-71295747 CACTGTGCGGGGCAGGGGGCAGG - Intronic
1070554617 10:77518010-77518032 CTCTGGGGAGGGAACGAGGCTGG - Intronic
1070695622 10:78561194-78561216 CTCTGTGAGGAAAAGGTGGGGGG + Intergenic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1071877312 10:89855106-89855128 CTCTGGGGGGTGGAGGTGGGAGG - Intergenic
1071879211 10:89876550-89876572 CTCTGGGGGGCCAAGGTGGGAGG + Intergenic
1072522171 10:96238394-96238416 ATGTGTGGGGGGAAAATGGCTGG + Intronic
1072554060 10:96501330-96501352 CTCTGTGGGTGGGAGGGGTCCGG - Intronic
1073134208 10:101211047-101211069 CTCTGTGGGGGGAAGAAAGAAGG - Intergenic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1073499334 10:103921747-103921769 TTCTGTAGGGGGAAAGTGGAGGG + Intergenic
1073729631 10:106272794-106272816 TACTCTGGGAGGAAGGTGGCTGG - Intergenic
1073886644 10:108047421-108047443 CTTTGTGGGGCCAAGGTGGATGG + Intergenic
1074236501 10:111589777-111589799 GACTGTGGTGGGAAGGTGGGAGG + Intergenic
1074403003 10:113157359-113157381 CTCTGAGGGGCGGAGGTGGGAGG - Intronic
1074502613 10:114040574-114040596 CGGTGTGGGGTGAAGGTGGGGGG + Intergenic
1074556542 10:114496491-114496513 GCCTGTTGGGGGAGGGTGGCGGG + Intronic
1074766229 10:116702022-116702044 CTCTGGGGGGCCAAGGTGGGAGG + Intronic
1075053330 10:119199459-119199481 CTCTGTTTGGGGGAGGTGGGAGG - Intergenic
1075370423 10:121930129-121930151 CTCGGTGAGGGGGATGTGGCAGG + Intergenic
1075520707 10:123142141-123142163 GTCTGCGGTGGGATGGTGGCAGG - Intergenic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1076746314 10:132516415-132516437 GGCTGTGGTGGGAAGGTGCCTGG + Intergenic
1076746887 10:132519029-132519051 CTCTGCGGGGTGAAGGTCGGAGG + Intergenic
1076820561 10:132936745-132936767 CTCTGTGCTGGGAGGGAGGCAGG + Intronic
1077085590 11:748258-748280 CTCCGTGGGCGGCAGGTGCCCGG + Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1077373584 11:2194998-2195020 CTTGGTGGGTGGCAGGTGGCAGG + Intergenic
1078061861 11:8052716-8052738 CTTTGTGAGGCCAAGGTGGCCGG - Intronic
1078640681 11:13092925-13092947 CTTTGTGGGGGCAAGGCGGGCGG - Intergenic
1078741856 11:14073968-14073990 CTCTGTGGAGGGGAAGGGGCAGG - Intronic
1079364383 11:19796653-19796675 CTCTGTGGAGGGAAGGCTGGTGG + Intronic
1080563595 11:33487341-33487363 CTAGGTGGGGGGCAGGTTGCTGG + Intergenic
1081613498 11:44577373-44577395 CCCTGAGGGAAGAAGGTGGCTGG - Intronic
1082749020 11:56998173-56998195 TCCTCTGGGAGGAAGGTGGCTGG + Intergenic
1083688394 11:64391462-64391484 CTCTCTGGAGATAAGGTGGCGGG + Intergenic
1083908185 11:65687908-65687930 CTCTGAGGGGGGAATGAGGTAGG + Intergenic
1084556391 11:69878713-69878735 CTCTGTGGGAGGGATGTGCCCGG - Intergenic
1084594405 11:70108471-70108493 CTCTGTGGGAGGCAGGCAGCCGG + Intronic
1084615266 11:70231615-70231637 CTGTGAGGGGGTAAGGAGGCAGG + Intergenic
1085298145 11:75442533-75442555 CTCTGTGGTCGGAGGGTGACAGG + Exonic
1085446897 11:76606748-76606770 GTCTGGAGAGGGAAGGTGGCAGG - Intergenic
1085545986 11:77318807-77318829 CTCTGTGAGGCCAAGGTGGGTGG + Intergenic
1085685339 11:78616691-78616713 CTTTGTGGGGTCAAGGTGGGAGG - Intergenic
1085811017 11:79681103-79681125 ATCTGTGGGGGAAAGGGGGTTGG + Intergenic
1086098192 11:83071492-83071514 CTCTGGCGGGGGAAGGTTGCTGG + Intronic
1087532268 11:99398922-99398944 TTAAGTGGGGTGAAGGTGGCAGG - Intronic
1088032264 11:105265597-105265619 CTCAGAGAGGGGAATGTGGCAGG - Intergenic
1088159802 11:106855262-106855284 ATCTGTGGTGGGAAAGTGGATGG + Intronic
1089790801 11:120942161-120942183 TTCTTTGGGGGAAAGGGGGCAGG + Intronic
1089982396 11:122783113-122783135 CTCTAGGGTGGGTAGGTGGCTGG - Exonic
1090247092 11:125224263-125224285 CTCTGTGGCTGGCAGGTGCCAGG + Intronic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1091274859 11:134343074-134343096 CTCTGTGGTGGGGAGGAGGAGGG - Intronic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1091695714 12:2626788-2626810 CTCTCAGTGGGGAAGATGGCAGG + Intronic
1091727340 12:2855184-2855206 GGCTGGGTGGGGAAGGTGGCAGG + Intronic
1092126543 12:6078763-6078785 CTCTGAGAGGGGAGGGTGCCTGG - Intronic
1092231613 12:6778728-6778750 CACTGTGGGTGGAAGGTGGGTGG - Intergenic
1092455141 12:8636410-8636432 CTCGGAGAGGGGAATGTGGCAGG - Intergenic
1093422722 12:18993642-18993664 CACTGAGGGGCTAAGGTGGCAGG + Intergenic
1094108853 12:26839735-26839757 CACTATGGGGGAAAGGTGGCTGG - Intergenic
1095111992 12:38305779-38305801 ACCTGTGGGGGGAAGGGGGAGGG + Intergenic
1096315751 12:50563737-50563759 CTTTGGGAGGGAAAGGTGGCAGG - Intronic
1096799974 12:54104024-54104046 CTATGTGGGGGGAGGCTGGGAGG - Intergenic
1097723783 12:63051520-63051542 CTGTGTGGCGTGACGGTGGCTGG + Intergenic
1097729324 12:63109619-63109641 CTTTGTGGGGTCAAGGTGGGTGG - Intergenic
1097962438 12:65545819-65545841 TTCTGAGTGGGGCAGGTGGCGGG - Intergenic
1098359801 12:69643240-69643262 GTCTGCAGTGGGAAGGTGGCTGG - Intergenic
1098680516 12:73348132-73348154 CTCGGTGAGGGGGATGTGGCAGG + Intergenic
1099233983 12:80060271-80060293 CTCTGTGGAGGGAGGTTGTCTGG + Intergenic
1100580848 12:95939200-95939222 CTCTGAGGGAGGAATGTGCCTGG + Intronic
1100597223 12:96082101-96082123 CTCTGGGAGGCTAAGGTGGCAGG + Intergenic
1101999687 12:109549269-109549291 CTCAGTGGTGGGAAGATGGGTGG - Intergenic
1103823351 12:123716308-123716330 CTCTGGGGGGCCAAGGTGGGGGG - Intronic
1103983344 12:124750922-124750944 CTTTCTGGGGTGAAGGGGGCGGG + Intergenic
1103995819 12:124829354-124829376 TTCTGTGGGGAGAACGGGGCGGG - Intronic
1104926556 12:132316923-132316945 CTCTGTGGGGTGTAGGATGCAGG - Intronic
1104926595 12:132317108-132317130 CTCTGTGGGGTGTAGGGTGCAGG - Intronic
1104933753 12:132353775-132353797 TTCAGTGAGGGGATGGTGGCAGG - Intergenic
1105371432 13:19805233-19805255 CTTTGTGGGGCCAAGGTGGGAGG - Intergenic
1106461945 13:29978717-29978739 CGCTCTGGGGTGAAGGTGCCAGG + Intergenic
1106621419 13:31374399-31374421 CTCTGTGAGGGGAATGGAGCAGG - Intergenic
1106998660 13:35518826-35518848 CGGTGTGGGGGGAAGGTTGCAGG + Intronic
1108331306 13:49387302-49387324 CCTTGTGGGGATAAGGTGGCAGG + Intronic
1109282892 13:60377561-60377583 CTCTGGGAGGGCAAGGTGGGCGG + Intergenic
1110855236 13:80289778-80289800 CTTTGAGGGGCGAAGGTGGGAGG + Intergenic
1112447373 13:99476574-99476596 GTGTGTGGGGGGGGGGTGGCGGG - Intergenic
1113233956 13:108248403-108248425 CTCTGTGGAGGGAGGGAGGGAGG + Intergenic
1113461892 13:110487992-110488014 CTTTGTGGGAGGAAGGGGGAGGG - Intronic
1113615897 13:111680578-111680600 TTCTTTCGGGGGACGGTGGCAGG + Intergenic
1113621365 13:111765471-111765493 TTCTTTCGGGGGACGGTGGCAGG + Intergenic
1113856076 13:113446129-113446151 CTCTCTGGGGGGGAGGGGGGAGG - Intronic
1114842490 14:26281712-26281734 CTCTTTGGAAGGGAGGTGGCTGG - Intergenic
1115474357 14:33799713-33799735 CTCTGTGTGGGGCGGGGGGCCGG - Exonic
1116672931 14:47866774-47866796 TTCTCTGAGGGGAAGGTGACGGG - Intergenic
1117683185 14:58226351-58226373 CTCTGGGAGGGCAAGGTGGGAGG - Intronic
1118808508 14:69257795-69257817 CTCCATGGGGGGAAGGAGGGAGG - Intergenic
1118951990 14:70443295-70443317 CTCTGGGTGGGGAAGGTGTTGGG + Intergenic
1119554891 14:75545755-75545777 GTGTGTGGGTGGGAGGTGGCGGG - Intronic
1119915595 14:78398424-78398446 CTCTGTCGGGGAAAGGTGGTTGG + Intronic
1121114731 14:91335618-91335640 CTCTGGGGAGGGAAGCAGGCAGG - Intronic
1121238351 14:92410034-92410056 ATTTGAGGGGGGAAGGTGGGAGG + Intronic
1121291558 14:92779934-92779956 CTCTGTGTTGGGATGGTGGGTGG - Intergenic
1121464707 14:94107988-94108010 GCCTGTTGGGGGAAGGGGGCTGG - Intronic
1121642805 14:95497141-95497163 CTGTGTGGGGGGACAGGGGCTGG - Intergenic
1121666998 14:95680170-95680192 CTCTGAAGGAGGAAGCTGGCTGG - Intergenic
1122241618 14:100372067-100372089 TTCTCTGGCGGGCAGGTGGCAGG - Intronic
1122452510 14:101821430-101821452 CCCTGTGGGGGGTGGGTGGGTGG + Intronic
1122642631 14:103169321-103169343 TCCTCTGGGAGGAAGGTGGCTGG - Intergenic
1122802844 14:104240205-104240227 CTCTGTGTGGGCGAGGAGGCTGG + Intergenic
1123210758 14:106758403-106758425 CTTTGTGGGGCCAAGGTGGGCGG - Intergenic
1123473155 15:20569468-20569490 CTCTGGGGAGGGGAGGTGCCAGG + Intergenic
1123489106 15:20765569-20765591 CTCAGATGGGGGAAGCTGGCAGG - Intergenic
1123545605 15:21334656-21334678 CTCAGATGGGGGAAGCTGGCAGG - Intergenic
1123644851 15:22430885-22430907 CTCTGGGGAGGGGAGGTGCCAGG - Intergenic
1123701212 15:22916113-22916135 TGACGTGGGGGGAAGGTGGCGGG - Intronic
1123733456 15:23164479-23164501 CTCTGGGGAGGGGAGGTGCCAGG + Intergenic
1123751587 15:23361854-23361876 CTCTGGGGAGGGGAGGTGCCAGG + Intronic
1124298738 15:28525835-28525857 CTCTGGGGAGGGGAGGTGCCAGG - Intronic
1125085199 15:35721737-35721759 CACTGTTGGGGGATGGCGGCAGG + Intergenic
1125258733 15:37798006-37798028 CTTTGAGAGGGGAAGGAGGCTGG - Intergenic
1125375087 15:39020233-39020255 GTCTGTGGTGTGAAGGGGGCAGG + Intergenic
1125765537 15:42132878-42132900 CTTTGGGGGGCCAAGGTGGCCGG + Intergenic
1126714247 15:51497298-51497320 ATCTGTGGGGGAAAGGTAGCTGG - Intronic
1127147426 15:56038942-56038964 CAGTGTTGGGGGAAGGTGGGAGG - Intergenic
1128477543 15:68010130-68010152 CTCTGTTGGGCTAAGGAGGCTGG + Intergenic
1128737277 15:70060305-70060327 CACTGTGGGGCGGAGGTGGATGG - Intronic
1128851573 15:70963021-70963043 CTTTGGGGGGGCAAGGTGGGAGG + Intronic
1128966928 15:72068718-72068740 CTTTGTGGGGCCAAGGTGGGAGG - Intronic
1129038104 15:72663163-72663185 CTCTGGGGAGGGGAGGTGCCAGG + Intronic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129211786 15:74074068-74074090 CTCTGGGGAGGGGAGGTGCCAGG - Intronic
1129398617 15:75267016-75267038 CTCTGGGGAGGGGAGGTGCCAGG + Intronic
1129402225 15:75291292-75291314 CTCTGGGGAGGGGAGGTGCCAGG + Intronic
1129475769 15:75783749-75783771 CTCTGGGGAGGGGAGGTGCCAGG + Intergenic
1129728909 15:77918340-77918362 CTCTGGGGAGGGGAGGTGCCAGG - Intergenic
1130186333 15:81687289-81687311 TTCTGTGGGGCAAGGGTGGCAGG - Intergenic
1130255711 15:82325185-82325207 TTCCCTGAGGGGAAGGTGGCAGG + Intergenic
1130255931 15:82326067-82326089 TTCCCTGAGGGGAAGGTGGCAGG + Intergenic
1130259461 15:82344176-82344198 CTCTGGGGAGGGGAGGTGCCAGG - Intronic
1130269217 15:82434992-82435014 CTCTGGGGAGGGGAGGTGCCAGG + Intronic
1130281805 15:82525009-82525031 CTCTGGGGAGGGGAGGTGCCAGG + Intergenic
1130473172 15:84241172-84241194 CTCTGGGGAGGGGAGGTGCCAGG + Intronic
1130480587 15:84355237-84355259 CTCTGGGGAGGGGAGGTGCCAGG + Intergenic
1130491125 15:84432522-84432544 CTCTGGGGAGGGGAGGTGCCAGG - Intergenic
1130502709 15:84511322-84511344 CTCTGGGGAGGGGAGGTGCCAGG - Intergenic
1130599251 15:85264801-85264823 TTCCCTGAGGGGAAGGTGGCAGG - Intergenic
1131057437 15:89383967-89383989 TTCTGAGGGGGAAAGGGGGCTGG - Intergenic
1131071682 15:89470141-89470163 CTCTGCTGGGGGAGGGAGGCTGG + Intergenic
1131134834 15:89926345-89926367 CTCTGAGAGGTGAAGGTGGGAGG + Intergenic
1131180658 15:90237200-90237222 CTCTGGGGGGCCAAGGTGGGTGG - Intronic
1131188093 15:90292524-90292546 CTCTGGGGAGGGGAGGTGCCAGG + Intronic
1131901275 15:97090296-97090318 CTTTGAGAAGGGAAGGTGGCTGG - Intergenic
1132142054 15:99404571-99404593 CTCTGTGGGATGTAGGAGGCTGG + Intergenic
1202953946 15_KI270727v1_random:61926-61948 CTCAGATGGGGGAAGCTGGCAGG - Intergenic
1132508108 16:322653-322675 CTCTGTGGGACTCAGGTGGCTGG - Intronic
1132572744 16:651134-651156 CTCGGTGGTGGGAGGGTGGGTGG + Intronic
1132667838 16:1090145-1090167 GTCTGTGGGGGGGCGGTAGCAGG - Exonic
1132691074 16:1182202-1182224 CTCTGCGGGGTGGAGGAGGCGGG + Intronic
1133020334 16:2964269-2964291 CTCTCCGGGGGGAATCTGGCCGG - Exonic
1133041785 16:3064856-3064878 CTCAGCTGGGGGAAGGGGGCTGG + Intergenic
1133396126 16:5448970-5448992 CCCTGTGGTGGGAAGGAGGACGG - Intergenic
1133884253 16:9810865-9810887 CTCTATGGGAGGAAGGAGGTGGG + Intronic
1133932079 16:10240810-10240832 CACACTGGGGGGAAGGGGGCAGG + Intergenic
1134117273 16:11558324-11558346 CTCTGTGGAGCCGAGGTGGCAGG + Intronic
1134808084 16:17142684-17142706 CTCTGTGAGGCCAAGGTGGGTGG - Intronic
1135818625 16:25658983-25659005 CTTTGTGGGGCCAAGGTGGGTGG + Intergenic
1135832536 16:25788781-25788803 CTTTGTGGGGGTGAGGTGGGAGG - Intronic
1136101594 16:28000787-28000809 CACTGTTGGGGGAAGGTTGTAGG - Intronic
1137655808 16:50156900-50156922 CTCTGTGAGGCCAAGGTGGGAGG - Intronic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1138460165 16:57143300-57143322 CTGTGTGTGGGCATGGTGGCTGG + Intronic
1139297118 16:65910621-65910643 CCCTATGGTGTGAAGGTGGCAGG + Intergenic
1139423836 16:66866554-66866576 CTCTGGGGGTGGAAGGTGGGGGG + Intronic
1139936085 16:70572186-70572208 CTCTGTGGGAGGAAGGAGGCAGG + Exonic
1139970179 16:70769425-70769447 CGCTGTGGGAAGAAGGTGGTGGG + Intronic
1140498259 16:75409100-75409122 CTCTGGGAGGCGAAGGTGGGTGG - Intronic
1141162452 16:81638453-81638475 CTCTCTGAGGGGATGGTGCCTGG + Intronic
1141440823 16:84028699-84028721 AGCGCTGGGGGGAAGGTGGCGGG - Intronic
1141676733 16:85521724-85521746 CTCTGTGGAGGGCAGGGGCCTGG + Intergenic
1141883192 16:86873358-86873380 TGCTGTGGGGTGAGGGTGGCTGG - Intergenic
1142005127 16:87686057-87686079 CTCCGTGGCTGGAGGGTGGCTGG + Intronic
1142028550 16:87827176-87827198 CTCTGGGGGGGGACAGGGGCTGG + Intergenic
1142234644 16:88915873-88915895 TCCTGAGAGGGGAAGGTGGCAGG - Intronic
1142635086 17:1252104-1252126 CGCTGTTGGGGGAAGGGGGGAGG - Intergenic
1142862463 17:2771147-2771169 CTCTCTGGAGGGAGAGTGGCAGG + Intergenic
1143116075 17:4582514-4582536 TTCTGGGGTGGGAAGGGGGCGGG - Intergenic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143389518 17:6552125-6552147 CTCTGAGGGGTGTAGCTGGCAGG - Intronic
1143645556 17:8227854-8227876 CGCTGTGGGGTGATGGTGACAGG - Exonic
1143659233 17:8314655-8314677 CTTTGTGAGGCCAAGGTGGCAGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144417781 17:15068290-15068312 CTTTTTGGGGGGAGGGGGGCAGG + Intergenic
1144574564 17:16420857-16420879 CTCTGGGGGGCCAAGGTGGAAGG - Intronic
1144703102 17:17351285-17351307 ACCTGTGGGGGGGAGGAGGCAGG + Intergenic
1144826484 17:18108270-18108292 CTCTGTGAGAACAAGGTGGCGGG + Intergenic
1145245442 17:21266116-21266138 CTTTGGGGGGGCAAGGTGGGCGG + Intergenic
1145250845 17:21296196-21296218 CACTGTGCGGGGCAGGTGGGTGG + Intronic
1146013392 17:29213508-29213530 TTCTGTGGGGCCAAGGTGGAAGG + Intergenic
1146182396 17:30706573-30706595 CTCTGTAGGGGGAAGTGGGTGGG + Intergenic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146272155 17:31491569-31491591 CCCTGAGGTGGGACGGTGGCTGG + Intronic
1146526768 17:33573425-33573447 CTCTGAGGAGGGAAGGTAGATGG - Intronic
1147164233 17:38585011-38585033 CTCTGTGGAGATAAGGAGGCTGG + Intronic
1147177020 17:38662312-38662334 CTCTGTGGAGGGCAGGTGCTGGG - Intergenic
1147341151 17:39753990-39754012 CTCTGCGGAGGGAAGGCCGCCGG + Intergenic
1147714150 17:42492770-42492792 CTTTGTGGGGACAAGGTGGAAGG + Intronic
1148153031 17:45407401-45407423 CTCTGTGGGGCCAAGGGTGCTGG - Intronic
1148282109 17:46356372-46356394 CTCTGGGGGGCCAAGGTGGACGG + Intronic
1148304327 17:46574295-46574317 CTCTGGGGGGCCAAGGTGGACGG + Intronic
1148345973 17:46903965-46903987 GTGTGTGGGTGGATGGTGGCTGG + Intergenic
1148583164 17:48757573-48757595 CACTGTGCTGGGGAGGTGGCTGG - Intergenic
1148745172 17:49914059-49914081 CCCAGTGGGGGCAAGGTGGGAGG + Intergenic
1148809057 17:50278931-50278953 CTCTCTGGGGGGATGATGGAGGG - Exonic
1148934131 17:51151338-51151360 CTCTGTGAGGCCAAGGTGGGCGG + Intergenic
1149296500 17:55265989-55266011 TTCTGTGCGGGGCAGGGGGCGGG + Intronic
1149324832 17:55519359-55519381 GTGTGTGGGTGGAATGTGGCGGG + Intergenic
1149608160 17:57939521-57939543 CTCTGGGGGGCCAAGGTGGGAGG - Intronic
1151682722 17:75630276-75630298 CTCTGTGGGTGCAAGGTAACAGG + Exonic
1152207759 17:78984175-78984197 CTTTGTGGGGCGGAGGTGGGTGG - Intergenic
1152241938 17:79165474-79165496 CCCTCTGGGGGACAGGTGGCGGG + Intronic
1152412805 17:80137720-80137742 CTCTATGGGGGGAGGGGGCCAGG + Intronic
1152814590 17:82399904-82399926 CTCTGGGGAGGGAAGGGGGATGG + Intronic
1152884523 17:82841788-82841810 CTCCGTGGGAGAAAGCTGGCAGG + Intronic
1153585108 18:6612793-6612815 CTCTCTGTGGAGAAGGAGGCAGG - Intergenic
1155034394 18:22013063-22013085 CTTTGTGGGGGTGAGGTGGGAGG + Intergenic
1155185437 18:23383205-23383227 CTCTGTGAGCAGCAGGTGGCTGG + Intronic
1155288126 18:24312890-24312912 CTCTGGGAGGGCAAGGTGGGCGG + Intronic
1155547131 18:26927462-26927484 CTCTGAGAGGGGGATGTGGCAGG + Intronic
1155839416 18:30628326-30628348 TCCTCTGGGAGGAAGGTGGCTGG + Intergenic
1155929313 18:31689320-31689342 CTATGGGGGTGGAAGGTGGGAGG + Intergenic
1156550907 18:38015654-38015676 CTGTCTGGGGGTAAGGTGGAGGG - Intergenic
1156782134 18:40863225-40863247 CTTTGAGGGGCGAAGGTGGGTGG - Intergenic
1157250232 18:46089079-46089101 CTCGGTGTGGGGGATGTGGCAGG - Intronic
1157606954 18:48931905-48931927 CACCCTGGGGGGAAGGTGGGGGG + Intronic
1157811923 18:50703360-50703382 CTCTGTGGAGTGAAAGTAGCTGG + Intronic
1158312383 18:56171855-56171877 CTTTGTGGGGCCAAGGTGGGAGG - Intergenic
1158669863 18:59464919-59464941 CTCTGTCGGGAGAGGTTGGCTGG - Intronic
1159114995 18:64104169-64104191 CACTGTGAGCGGCAGGTGGCGGG + Intergenic
1159336680 18:67076982-67077004 CTCTGAGAGGGGGATGTGGCAGG + Intergenic
1159477515 18:68942466-68942488 CTCAGAGAGGGGAATGTGGCAGG + Intronic
1159624017 18:70670494-70670516 TTCTGTAGGGGGATGATGGCTGG + Intergenic
1159760755 18:72422731-72422753 GTCTGTGTGGGGAAGGTGTTTGG - Intergenic
1160246878 18:77166246-77166268 CTCTGTGGGAGGAAGGTGGGAGG - Intergenic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160584671 18:79905614-79905636 CTGCGTGGGGCGAAGGTGACCGG - Intronic
1160605589 18:80047261-80047283 CTTTTTGGGGAGGAGGTGGCAGG - Intronic
1161144897 19:2671589-2671611 CCCTGAGGCGGGAAGGTGACGGG + Intronic
1161377377 19:3946886-3946908 CTCTGTGGGGCCAAGGTGGGTGG + Intergenic
1161596791 19:5154665-5154687 GTCTGTGGTGGGACGGGGGCTGG + Intergenic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1162713978 19:12617365-12617387 CTCTGGGGGGCCAAGGTGGGCGG - Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1162976428 19:14209228-14209250 CTCTGTAGGGGGAAGTGGGTGGG - Intergenic
1164189575 19:22901801-22901823 GGCTGTGGTGGGAAGGTGGGCGG + Intergenic
1164433677 19:28209672-28209694 TTCTGTGGTGTGAAGCTGGCTGG - Intergenic
1165547102 19:36548775-36548797 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1165655657 19:37529997-37530019 CTCGGTGAGGGGGATGTGGCAGG + Intronic
1165944908 19:39436128-39436150 CTCTGTGGGCGGAAGGGGCGGGG + Intergenic
1166284299 19:41814302-41814324 CTCTGTGGGTGGGAAGTGGTGGG - Intergenic
1166368270 19:42288002-42288024 CTCTCGGGGAGGGAGGTGGCAGG - Intronic
1166659874 19:44639821-44639843 CTCGGTGAGGGGGATGTGGCAGG - Intergenic
1167266704 19:48486394-48486416 CTCTGTGGAGGGGACGTTGCAGG - Intronic
1167276279 19:48541957-48541979 CCCTGTGGTGGAAAGGTGCCTGG - Intergenic
1167706240 19:51082801-51082823 CTCTGCGGGCGGCAGGTGGGAGG + Exonic
1167767015 19:51490336-51490358 CTGTGTGGGGAGAAAGAGGCCGG - Intronic
1167820755 19:51925664-51925686 CTCGGTGAGGGGGATGTGGCAGG - Intronic
1167824343 19:51958556-51958578 CTCGGTGAGGGGGATGTGGCAGG - Intergenic
1167883783 19:52484048-52484070 CTCAGAGAGGGGAATGTGGCAGG + Intronic
1167991428 19:53364571-53364593 CTTTGTGAGGGGAGTGTGGCAGG - Intergenic
1168000792 19:53444540-53444562 CTCAGTGAGGGGAATGTGGCAGG - Intronic
1168420162 19:56196665-56196687 CTCTGGGAGGCGGAGGTGGCAGG + Intronic
925135276 2:1522288-1522310 GACTGTGAGGGCAAGGTGGCAGG - Intronic
925135285 2:1522328-1522350 GTCTGTGAGGGCACGGTGGCAGG - Intronic
925135314 2:1522448-1522470 GTCTGTGAGGGCACGGTGGCAGG - Intronic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926041334 2:9675703-9675725 CTCTATGGCGGGGAGGTCGCAGG + Intergenic
926163103 2:10501869-10501891 CCCAGTGGAGGGAAGGAGGCTGG - Intergenic
926494009 2:13561533-13561555 TTCTGTGGGGGGATGATTGCAGG - Intergenic
927152491 2:20203976-20203998 CTGTGGGGGTGGGAGGTGGCGGG + Exonic
927459714 2:23287520-23287542 CTCTGTCTGGGAAAGGTGCCAGG - Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927664472 2:25020765-25020787 CTCTGGGGGGCCAAGGTGGGTGG - Intergenic
927930093 2:27038367-27038389 CTCTGTGGGTGGTAGGTGGAGGG + Intronic
929445552 2:41998197-41998219 CTCCCTGGGGAGAAGCTGGCAGG + Intergenic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
929949539 2:46395987-46396009 CTTTGTGGGGCCAAGGTGGGAGG + Intergenic
929976970 2:46644301-46644323 CTCTGGGAGGGCAAGGTGGGTGG + Intergenic
930120595 2:47757581-47757603 CTTTGTGGGGTGAAGGTAGGAGG - Intronic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930818468 2:55621972-55621994 CTCTGTGCGGGGCTTGTGGCTGG - Intergenic
932430666 2:71672060-71672082 GACTCTGGGGAGAAGGTGGCTGG + Intronic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
933825593 2:86157424-86157446 CTCTCTGGGCTGAAGGTGTCAGG - Intronic
934019258 2:87928193-87928215 ATCGGAGGGTGGAAGGTGGCAGG - Intergenic
934054591 2:88241222-88241244 AGCAGTGGGGAGAAGGTGGCCGG - Intergenic
934761571 2:96859654-96859676 CTCTCTGGGTGGAGGGAGGCTGG - Intergenic
936044540 2:109176486-109176508 CTTTGTGGGGCCAAGGTGGGAGG + Intronic
936343075 2:111654840-111654862 CAGTGTGGGAGGAAGGTGTCAGG - Intergenic
936502217 2:113075131-113075153 TCCTGTGGGGGCAAGGTGGATGG - Exonic
936970698 2:118173760-118173782 CTCTGTGGGGGCAGTGTGGGTGG + Intergenic
937231047 2:120398429-120398451 CTATGTGGGAGGCAGGAGGCAGG + Intergenic
937350345 2:121156534-121156556 CTCTTGGTGGGGAAGGGGGCCGG - Intergenic
937879638 2:126855874-126855896 CTCTGTGTAGGGAAGGTGGGAGG - Intergenic
937989026 2:127652073-127652095 TTCTGTAGCGGGAAGGAGGCTGG - Exonic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
938779812 2:134575039-134575061 CTCTGTGGGGGGGTGGGGGAAGG + Intronic
942545417 2:177058264-177058286 CTTTGGGGTGGGAGGGTGGCGGG + Intergenic
943382966 2:187173383-187173405 TCCTCTGGGAGGAAGGTGGCTGG + Intergenic
944261820 2:197686195-197686217 GACTGTGGGGGAAAGGTGGGAGG - Intergenic
945278854 2:208016399-208016421 CTTTGGGGGGAGATGGTGGCAGG + Intronic
945725106 2:213465515-213465537 TTCTCTGGGAGGGAGGTGGCTGG + Intronic
946167976 2:217877039-217877061 CTCTGTTGTGGGACAGTGGCTGG - Intronic
946229723 2:218283729-218283751 TTCAGAGAGGGGAAGGTGGCAGG + Intronic
946556764 2:220867153-220867175 CCCTGTGCTGGGAAGATGGCAGG + Intergenic
947498956 2:230658626-230658648 CCCAGTGGGGGGCTGGTGGCTGG - Intergenic
948455389 2:238102260-238102282 CACTGTGGGGGTGAGCTGGCAGG + Intronic
948504006 2:238415627-238415649 CTCTGTGTGGGGCTTGTGGCTGG + Intergenic
1168875931 20:1172106-1172128 CTCTGTGGGGGAGAGGAGGAGGG - Intronic
1170682917 20:18542880-18542902 CTTTGGGAGGGCAAGGTGGCAGG - Intronic
1170748723 20:19124701-19124723 TTCTGTGGGGGGGCGGGGGCGGG - Intergenic
1171495284 20:25550541-25550563 CTCGGTGAGGGGGATGTGGCAGG + Intronic
1172182979 20:33014884-33014906 CTCCCTGGGGGGGAGGTGGGAGG - Intronic
1172263464 20:33590007-33590029 CTTTGTGAGGCCAAGGTGGCAGG + Intronic
1172328653 20:34058076-34058098 CTTTTTGAGGGGAAGGGGGCCGG + Intronic
1172338484 20:34136359-34136381 CTCTGCGAGGGGAGTGTGGCGGG - Intergenic
1172368665 20:34369858-34369880 CTTTGTGGGGCGAAGGTGGGAGG + Intronic
1172789514 20:37493141-37493163 CCCTGGTGGGAGAAGGTGGCTGG + Intronic
1173285972 20:41671695-41671717 CTCTGTGGGGCTGAGGTGGGAGG + Intergenic
1173353691 20:42267698-42267720 CTTTGTTGGGGGCCGGTGGCAGG - Intronic
1174048329 20:47749572-47749594 CTCTGTAGGGGCCAGATGGCTGG - Intronic
1174949351 20:55027618-55027640 CTCTGAGGGGGGAATGAGGTAGG - Intergenic
1175064598 20:56274116-56274138 CCCTCTGGGAGGAAAGTGGCTGG - Intergenic
1175361183 20:58413829-58413851 CTATCTGGGAGGGAGGTGGCGGG - Intronic
1175361254 20:58414005-58414027 CTATCTGGGAGGGAGGTGGCGGG - Intronic
1175654763 20:60760533-60760555 CTCTGTAGTGGGGAGGTGGGTGG - Intergenic
1175987890 20:62773067-62773089 CTCTGTGCTGGGGAGGGGGCAGG + Intergenic
1176023905 20:62976174-62976196 CTCTGCTGGGGGAAGGTTGGGGG - Intergenic
1176184219 20:63769318-63769340 CTCTGAGGGTGGAGGGTGGAGGG + Intronic
1177524462 21:22273862-22273884 CCCTGTCAGGGGTAGGTGGCTGG + Intergenic
1177773203 21:25539731-25539753 CTCTGTGTGGGGCTTGTGGCTGG - Intergenic
1177819632 21:26016925-26016947 CTTTGTGGGGGGCGGGGGGCGGG + Intronic
1177867100 21:26525485-26525507 CTCTGGGGAAGGAAGGCGGCAGG - Intronic
1178446336 21:32647042-32647064 CTTTGTGGGGTGAGGGTTGCAGG - Intronic
1178896129 21:36559438-36559460 CTTTGTGGGGCCAAGGTGGGCGG - Intronic
1179411504 21:41167210-41167232 GGGGGTGGGGGGAAGGTGGCTGG + Intergenic
1179621448 21:42618873-42618895 CTCTAAGGGTGGAGGGTGGCAGG - Intergenic
1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG + Intergenic
1180864490 22:19108464-19108486 CTCGGTGAGGGTGAGGTGGCAGG + Intronic
1180882006 22:19210974-19210996 CTTTGTGGGGGCAAGGTGGGAGG - Intronic
1181618532 22:24071665-24071687 CTCTGTGGCTGGAAAGCGGCTGG - Intronic
1182315912 22:29447139-29447161 CTTTCTGGGGTGAAGGTGGGTGG - Intergenic
1184287001 22:43477491-43477513 CTCTGCTGGGGCATGGTGGCAGG - Intronic
1184606341 22:45576811-45576833 CCCTGTGTGGGGAGGGTGGAGGG - Intronic
1184729711 22:46365823-46365845 GTATGTGGGGGAAAGGTGGTGGG + Intronic
1184729726 22:46365854-46365876 TTGGGTGGGGGGAAGGTGGTGGG + Intronic
1184729766 22:46365945-46365967 CTGGGTGGGGGAAAGGTGGTGGG + Intronic
1184966355 22:47975133-47975155 CTCTGGGGGGCCAAGGTGGGTGG - Intergenic
1185175422 22:49323844-49323866 CACTGGGGAGGGAGGGTGGCAGG - Intergenic
1185223835 22:49642173-49642195 CTATCTGGGGGGAAGGTGCCAGG - Intronic
1185243103 22:49756861-49756883 CACTGTGGGGTGAAGGTGGAGGG - Intergenic
1185287943 22:50010788-50010810 CGCGCTGGGGGGAAGGTGGGGGG + Intronic
949884681 3:8683765-8683787 CTCTGAGGCCGGGAGGTGGCAGG - Intronic
950083277 3:10238929-10238951 CTCTGTGGGGAGAAGTGGGGTGG - Exonic
950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG + Intergenic
950567947 3:13782359-13782381 CTCTGTGTGGGGAGGGAGGTCGG - Intergenic
950939288 3:16877085-16877107 TGCTGTGGGGGGAAGGTGACTGG - Intronic
951235827 3:20235364-20235386 CTCTGTGTGGGGAAGAGGGTGGG + Intergenic
951715767 3:25644455-25644477 CTCTGGGGGGCCAAGGTGGATGG + Intronic
952387971 3:32856544-32856566 CTCTGTTGGTGGAAGGTGAAAGG + Intronic
952753343 3:36843587-36843609 CTCTGGGGGATGCAGGTGGCAGG - Intronic
952757985 3:36889158-36889180 CTCTGTGGAAGGGAGGTGACAGG - Intronic
953059891 3:39418493-39418515 CTCAGAGAGGGGGAGGTGGCAGG + Intergenic
953184438 3:40625143-40625165 GCCTGTGTGGGGAAGGTGGGAGG + Intergenic
953637604 3:44676211-44676233 CTCTGACCGGGGAAGTTGGCTGG - Intergenic
954362611 3:50130233-50130255 CTTTGGGAGGGCAAGGTGGCTGG - Intergenic
954594600 3:51813989-51814011 GGCTGTGGGGGGATGGTGGTGGG + Intergenic
954861319 3:53693211-53693233 GTCTGTGGGGGGAAGACAGCTGG - Intronic
955047470 3:55373622-55373644 GTTTGTGGGTGGAAGGTGGGAGG + Intergenic
955615611 3:60803749-60803771 CTCTTTGAGGGGAAAATGGCAGG - Intronic
956426977 3:69145963-69145985 CTCTGTGGGGTGAGGGTGGGGGG - Intergenic
956499304 3:69864793-69864815 CTATGAGGTGGGAAGTTGGCAGG - Intronic
956557378 3:70538738-70538760 TCCTCTGGGAGGAAGGTGGCTGG + Intergenic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
958001392 3:87753775-87753797 CTCTGTGGAGACAAGGTGACTGG - Intergenic
958925931 3:100156997-100157019 CTTTGTGGGGCCAAGGTGGGAGG - Intronic
959369404 3:105504637-105504659 ATCGGCGGGGGGAAGGTGGGGGG - Intronic
960354087 3:116629469-116629491 TCCTGTGGGGAGAAGATGGCTGG + Intronic
960510140 3:118540048-118540070 CTCGGGGAGGGGAATGTGGCAGG + Intergenic
961135195 3:124503540-124503562 ATCTGTGGTAGGCAGGTGGCTGG + Intronic
961631657 3:128304483-128304505 GTCTGTTTTGGGAAGGTGGCGGG - Intronic
962149888 3:132881534-132881556 CTTTTTGGGGGGAAGGTGGGAGG + Intergenic
963468151 3:145709449-145709471 CTCTGAGAGGGGGATGTGGCAGG + Intergenic
963759366 3:149271673-149271695 GTCTGGGGGGTGAAGGTGGGAGG - Intergenic
964794984 3:160487190-160487212 CTTTGTGGGGCCAAGGTGGTTGG - Intergenic
964852046 3:161105259-161105281 CTCGGAAGCGGGAAGGTGGCCGG + Exonic
965499753 3:169443358-169443380 CTCTGTGGGGGGAAGGGAAGGGG + Intronic
965608898 3:170524399-170524421 CTGTGATGGGGGTAGGTGGCAGG + Intronic
966421012 3:179733988-179734010 CTCAGTGTGTGGATGGTGGCAGG + Intronic
966772991 3:183520551-183520573 CTCGGTGAGGGGGATGTGGCAGG + Intronic
967282304 3:187834042-187834064 CCCTGTGTGAAGAAGGTGGCTGG + Intergenic
968039245 3:195574509-195574531 CACTGTGTGGGGAAGGTCGAGGG + Intronic
968224180 3:196962830-196962852 CTCAGTGAGGGGGATGTGGCAGG - Intronic
968230344 3:197002068-197002090 CCCGGTGGGGTGAAGGTGCCCGG + Exonic
968614816 4:1572653-1572675 CTTGGTCGGGGGAAGGGGGCTGG + Intergenic
968763726 4:2457436-2457458 CTCTGTGGCAGGAAGGAGGAGGG + Intronic
968771730 4:2511805-2511827 CTCTGTGGGTGGGAGGAGGGTGG + Intronic
969606287 4:8203884-8203906 CTCTGGGCGGGGAACGTGGCAGG - Intronic
970040071 4:11786709-11786731 CTTCATGGGGGGAAGGTGGGAGG - Intergenic
970374909 4:15447277-15447299 CTCTGTGGTGGTAATGTGGCTGG - Intergenic
971026905 4:22597990-22598012 CTCGGAGAGGGGAATGTGGCAGG + Intergenic
971310742 4:25523754-25523776 CTTTGGGGGGCTAAGGTGGCCGG + Intergenic
972079955 4:35138221-35138243 GTGTGTGGGAGGGAGGTGGCTGG + Intergenic
973636584 4:52866733-52866755 ATCTGTGGAGGGGATGTGGCAGG - Exonic
973993734 4:56436211-56436233 CGCTGGGCGGGGAAGGAGGCGGG - Exonic
974088279 4:57284105-57284127 CTCTATTGGGGGAAGCTGGGTGG - Intergenic
974565555 4:63575461-63575483 TTCTCTGGGTGAAAGGTGGCTGG + Intergenic
974611951 4:64229098-64229120 TTTTGGGGGAGGAAGGTGGCTGG + Intergenic
974615312 4:64272130-64272152 CTAGGTGGGAGCAAGGTGGCAGG + Intergenic
974905799 4:68055083-68055105 CTCTGTGGCGCGAAGGAGCCTGG + Intronic
977292961 4:95182937-95182959 CTCTGTGTGCGGCAGGTGGAAGG - Exonic
977569280 4:98612814-98612836 CCCTGTGGGGGGAGGGAGGAAGG - Intronic
978034763 4:103978615-103978637 CTCTCTGGGGGAAATGAGGCAGG + Intergenic
978285550 4:107073325-107073347 CTCTGTGGGGGGCAGGACTCAGG + Intronic
978491801 4:109317898-109317920 TCCTCTGGGAGGAAGGTGGCTGG - Intergenic
979082860 4:116364077-116364099 GTCTGAGGGTGGAAGGTGGGAGG - Intergenic
980187699 4:129482504-129482526 CTCTGGGGGGCCAAGGTGGGAGG - Intergenic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
980456831 4:133055007-133055029 CACTGTGGGGGGAGGGGGGAGGG + Intergenic
980524818 4:133976105-133976127 CTCTGTTGGGGGAAGGTGGCAGG - Intergenic
981388364 4:144158223-144158245 CCTTGTGGGTGGAGGGTGGCAGG - Intergenic
982022905 4:151222170-151222192 CTCTGTGGGTGGAACTTGGAGGG - Intronic
983501008 4:168499659-168499681 CTCTGTGGGGGGATTTAGGCAGG - Intronic
983653078 4:170052932-170052954 GTCTGTGGGGAGAAGGGGACAGG + Intergenic
984999235 4:185468574-185468596 CCCTGTGGTGGGAGCGTGGCTGG - Intronic
985658538 5:1144198-1144220 CTCAGGGAGGGGAAGTTGGCCGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985850044 5:2382164-2382186 GGCTGTGGGTGGAAGCTGGCCGG - Intergenic
985939474 5:3123190-3123212 CTCTTTGGGGGCAGGGTGGCTGG + Intergenic
986167093 5:5283466-5283488 CTTTCTGGGGGGGAGGTGGGGGG - Intronic
987628554 5:20435688-20435710 TTATGTGGGAGCAAGGTGGCAGG - Intronic
988483099 5:31645937-31645959 CTCAGTAGGGGGAAGGGGGTGGG + Intronic
988603927 5:32664388-32664410 TTCCCTGGGAGGAAGGTGGCTGG + Intergenic
989313495 5:40049628-40049650 TTCTGTGGGGCAAAGGAGGCAGG - Intergenic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
989837362 5:46009147-46009169 CTCAGAGAGGGGGAGGTGGCAGG + Intergenic
990888734 5:60624892-60624914 CTGTGTGGGGGGTCGGGGGCAGG - Intronic
992499488 5:77327860-77327882 CTGTGTGGGGGGAAGGCTCCCGG - Intronic
992523153 5:77577302-77577324 TTTGGTGGGGGGAAGGGGGCAGG - Intronic
992950628 5:81853694-81853716 CACGGTGGGGGGATGGTGGCAGG + Intergenic
993384700 5:87251061-87251083 CTGTGTGGGGGGATGGGGGGTGG - Intergenic
994422013 5:99534271-99534293 CTCTGTGTAGGGATAGTGGCTGG - Intergenic
994774916 5:104028705-104028727 TACTCTGGGAGGAAGGTGGCTGG - Intergenic
995134459 5:108665974-108665996 GACTTTGGGGGGAAGGTGGGAGG - Intergenic
995416991 5:111923430-111923452 TCCTCTGGGAGGAAGGTGGCTGG + Intronic
995513032 5:112926844-112926866 CTTTGTGGGGTCAAGGTGGGAGG - Intergenic
996756905 5:126945257-126945279 CTCTCTGGGGGAAAGGAGGAGGG - Intronic
997691598 5:135831117-135831139 CTCTGTGGGGGAAATGTGGCTGG + Intergenic
999276423 5:150333685-150333707 CTGTGTGGGGTGAAGGGAGCAGG - Intronic
999989237 5:157034200-157034222 CTCAGTGAGGGGGATGTGGCAGG + Intronic
1000070928 5:157740508-157740530 CTCTGAAGGGGGAAGGTAGTGGG + Exonic
1000162534 5:158613630-158613652 CTCTTTGGGGGGAAAGTGTAGGG + Intergenic
1000245953 5:159448736-159448758 CTCTGAGAGGGGAAGGAAGCGGG + Intergenic
1000436032 5:161209722-161209744 CTCGGTTGGGGGGAGGTGGGAGG + Intergenic
1000619254 5:163464370-163464392 CTCTGTGAGGCCAAGGTGGGTGG + Intronic
1000903653 5:166937085-166937107 CTCTGGGGGGCGGAGGTGGGTGG - Intergenic
1001571218 5:172731939-172731961 CACAGTGGGGGGAGGGTAGCAGG + Intergenic
1001586100 5:172834648-172834670 CTCGGCGGAGGGAAGGTGGGTGG - Intronic
1001860210 5:175047763-175047785 CTCTGGGGCAGGAGGGTGGCAGG + Intergenic
1002165848 5:177345095-177345117 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1002466799 5:179412325-179412347 GTCGGTGGGGGAAAGGTGGAAGG - Intergenic
1002467074 5:179412964-179412986 GTCGGTGGGGGGAGGGTGGAAGG - Intergenic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1002807810 6:594081-594103 CTCTGTGCTGAGAAAGTGGCAGG + Intronic
1003514115 6:6804247-6804269 CTATGGGAGGGGAAGGAGGCAGG + Intergenic
1003645965 6:7912988-7913010 ATCTGTGGGGAGAATGTGGCAGG - Intronic
1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG + Intronic
1004226311 6:13787772-13787794 CTAGGAGGGGGGAAGATGGCTGG - Exonic
1004284153 6:14305088-14305110 CTCTGTGCTGGGAAGAAGGCAGG + Intergenic
1004498383 6:16186244-16186266 TTCTGTGGTGGGAAGGTGAAAGG - Intergenic
1005025652 6:21460671-21460693 CTCTGGGAGGGCAAGGTGGGTGG + Intergenic
1006289284 6:33122136-33122158 CTCAGTGAGGGGGATGTGGCAGG + Intergenic
1006376316 6:33673499-33673521 CTTTATGGGGGGCAGGGGGCAGG - Intronic
1006432815 6:34008189-34008211 CCCTGGGGTGGGAAGGGGGCTGG - Intergenic
1006836157 6:36999947-36999969 CTCAGATGGGGGAAGGTGGGAGG - Intergenic
1006836417 6:37001675-37001697 CTCAGATGGGGGAAGGTGGGAGG + Intergenic
1006844289 6:37051732-37051754 CCCTGTGGGAGGAAGGAGGTGGG - Intergenic
1006879950 6:37330897-37330919 CTGTTTGGGAGGAAGGAGGCTGG + Intronic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1006954510 6:37855673-37855695 CTTTTTGGGGGGCAGGTGGTGGG + Intronic
1007784838 6:44273582-44273604 CTCCCTGGGGGGAAGGTGGGAGG + Intronic
1008542383 6:52556523-52556545 CTCTGTGGGGGCAAGGCGAGTGG - Intronic
1010149072 6:72709085-72709107 CTTTGTGGGGCCAAGGTGGGTGG - Intronic
1010845237 6:80699243-80699265 CTCTGGGGTGGGAAGGTGTGAGG - Intergenic
1011746888 6:90415066-90415088 TTCTGTGTAGGGAAGGGGGCTGG + Intergenic
1012166167 6:95955211-95955233 CTCAGAGGGTGGAAGGTGGGAGG + Intergenic
1012525297 6:100170056-100170078 CTCAGTGGGGAGAAGGTGTTTGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014276662 6:119396795-119396817 TCCTCTGGGAGGAAGGTGGCTGG + Intergenic
1014348559 6:120309090-120309112 CATTGTGGGGGAAAGGAGGCTGG - Intergenic
1015496461 6:133888905-133888927 CACAGTTGGGAGAAGGTGGCTGG + Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1015685113 6:135850685-135850707 CTCTGTCGTGGGAATGGGGCTGG + Intergenic
1015821952 6:137270913-137270935 ATCAGAGGGGGGAAGGTGGGAGG + Intergenic
1016739468 6:147512199-147512221 CTCTGGGAGGCCAAGGTGGCTGG - Intronic
1016848639 6:148594052-148594074 CTCTCTGGGAGGAAGGTCACAGG - Intergenic
1016935300 6:149445379-149445401 TCCTGTGGGAGGAAGGTGGAAGG - Intergenic
1017129287 6:151094164-151094186 GTCAGTGGGGAGAAGGAGGCGGG - Intronic
1018229703 6:161663822-161663844 CCCTGTGGTGAGAGGGTGGCTGG + Intronic
1018811962 6:167304941-167304963 CCTTGAGGGGAGAAGGTGGCAGG - Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1018910401 6:168098292-168098314 CTCGGTGGGGGGAGTGTGGGAGG - Intergenic
1018926436 6:168209932-168209954 CTCTGTGGGGAGCAGGAGGCCGG - Intergenic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1019442745 7:1055693-1055715 CTCTGTGGGGTGAAGGTGGCCGG + Intronic
1019737310 7:2656920-2656942 CGCTGTGGGGGAAAGGTTGGTGG + Intronic
1019863611 7:3684063-3684085 CGCTGTGGGGTGGTGGTGGCAGG + Intronic
1019917819 7:4144724-4144746 CTCTGTGGGGAGGAGCTGCCGGG - Intronic
1019982649 7:4632786-4632808 TTTTGTGGGGGGAAGGTGGCAGG + Intergenic
1020247135 7:6438463-6438485 CTCTGAGGGGGAAAGGGTGCAGG + Intronic
1020267059 7:6567929-6567951 GTGTGTGGGGGGAAGGTGACGGG + Intergenic
1020763383 7:12293432-12293454 TCCTTTGGGAGGAAGGTGGCTGG - Intergenic
1021059179 7:16088793-16088815 CTTTATGCTGGGAAGGTGGCTGG + Intergenic
1021496091 7:21276240-21276262 CTCTGGGGAGGGGAGGAGGCTGG - Intergenic
1021710141 7:23407934-23407956 ATTTGTGGGGGGCAGGGGGCGGG + Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022854073 7:34298368-34298390 CTTTGTGGGAAGAAGGTGGGAGG - Intergenic
1022991996 7:35717780-35717802 CTCTGTGAGGCCAAGGTGGGCGG + Intergenic
1023605998 7:41931498-41931520 CTCTGTGCTGAGAAGGTTGCTGG + Intergenic
1023939636 7:44761346-44761368 GTCCCTGCGGGGAAGGTGGCTGG + Intronic
1024224502 7:47315312-47315334 CCCTGCGGGGGTGAGGTGGCCGG + Intronic
1024527254 7:50359406-50359428 CTCTGTGGGCAGAAGGCTGCAGG - Intronic
1025045996 7:55692439-55692461 CTCTGGGAGGCCAAGGTGGCAGG + Intergenic
1025064594 7:55842361-55842383 CTCTGGGAGGGCAAGGTGGGTGG + Intronic
1026140188 7:67699065-67699087 CTCTGTTGGGGGAAGTGGGGTGG + Intergenic
1026461854 7:70621301-70621323 CACTGTGGGGGCAGGGTGGGGGG + Intronic
1026592300 7:71707449-71707471 CCCTGTTGTGGGAAGGTTGCCGG + Intronic
1026897468 7:74018534-74018556 CTCTGGGAGGGGCAGGGGGCAGG + Intergenic
1027173290 7:75888005-75888027 CTCTGTGTGGGGTAGGAGCCAGG - Exonic
1027190988 7:75995286-75995308 CTCTGTGGAGGGATGGGGGTGGG - Intergenic
1029116803 7:98241800-98241822 TGCTGTAGGGGGATGGTGGCAGG - Intronic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1029230449 7:99063531-99063553 CTTTGTGGGGCGAAGTTGGGAGG - Intronic
1029278007 7:99418987-99419009 CTCTGGTGGGGGAAGAGGGCAGG - Exonic
1029605496 7:101597270-101597292 CTCTGGGGGGCCAAGGTGGGAGG - Intergenic
1032768979 7:135029173-135029195 CTCTTAGGGGTGAATGTGGCTGG - Intronic
1033521105 7:142161045-142161067 CCCTGGGGGATGAAGGTGGCTGG + Intronic
1035051130 7:155999566-155999588 CCCTGGGAGGGGAAGGTGGCTGG + Intergenic
1035414432 7:158671072-158671094 CTCTGTGTGGGGCAGGGGGGTGG + Intronic
1035414455 7:158671154-158671176 CTCTGTGTGGGGCAGGGGGGTGG + Intronic
1035438853 7:158879088-158879110 CTCTGTGGGAGCGAGGTGGCTGG + Intronic
1035836906 8:2764567-2764589 CTCTGTGGCAGCAAGGTGGAAGG + Intergenic
1037814867 8:22106833-22106855 CTCTGTGGGGAGAAAGTGATGGG - Intergenic
1037973509 8:23192152-23192174 CTCTGTGGATGGGAGGTGGGTGG - Intronic
1038202000 8:25421590-25421612 CTCGGAGGGGAGAACGTGGCTGG + Exonic
1038340744 8:26683175-26683197 CTCGGAGAGGGGAATGTGGCAGG + Intergenic
1038516052 8:28188472-28188494 CTCCGGGGAGGGAAGGGGGCTGG + Intronic
1038626322 8:29196984-29197006 TTCAGTGGGAGGAAGGTGGGAGG - Intronic
1039300663 8:36205284-36205306 CTCTGTGGGGGGGAGCTGCAGGG + Intergenic
1039418827 8:37418957-37418979 CTTTTTGGGGGGAAGCTGGGGGG + Intergenic
1039945324 8:42123820-42123842 CCCTGGGAGGGGAGGGTGGCTGG - Intergenic
1040106350 8:43544452-43544474 CTCTGTGGGGGCAGGCTGGAAGG + Intergenic
1040826276 8:51623848-51623870 CTCTGTGAGGCCAAGGTGGAAGG + Intronic
1041340071 8:56835619-56835641 GTTTGTGGGGGGAAGGAGGAAGG - Intergenic
1041645795 8:60251179-60251201 CTATCTGGGGGCAAGGTGGGAGG + Intronic
1042557328 8:70044416-70044438 TTCTGTGTGGGGAAGGTAGGGGG - Intergenic
1043251970 8:78086359-78086381 CTCTGTGGGAGAAAGGTGGGAGG - Intergenic
1043440628 8:80274161-80274183 CTTTGTGGGGCCAAGGTGGGAGG - Intergenic
1043875760 8:85484392-85484414 CTCAGTGGTGGCAGGGTGGCTGG + Intergenic
1045630073 8:104108540-104108562 CTCTGGGGGGCCAAGGTGGAAGG - Intronic
1045724839 8:105160077-105160099 CTCTGTGTCTGGAAGGTGGTAGG + Intronic
1047100444 8:121669716-121669738 GACTGTGGGAGGCAGGTGGCTGG + Intergenic
1047336900 8:123944763-123944785 CCCTGTGAGGGAAAGGAGGCTGG - Intronic
1047419184 8:124692576-124692598 CTCTGAGGGGAGAAGGTGCTGGG - Intronic
1047693218 8:127377649-127377671 TGCTGTGGGGAGAAGGTGCCTGG - Intergenic
1048298502 8:133234294-133234316 GTATGTGGGGGGAAGGGGGCAGG + Intergenic
1048328531 8:133456576-133456598 ATCCCTGGGGTGAAGGTGGCTGG - Exonic
1049368265 8:142251324-142251346 TTTTGTGGGGGGAGGGGGGCGGG - Intronic
1049426756 8:142541192-142541214 CTCTGTCAGGGGCAGGCGGCTGG + Intronic
1049541485 8:143211141-143211163 CCCTGTGGAGGGGAGGCGGCAGG + Intergenic
1049559596 8:143302630-143302652 CTCTGTGAGGCCAAGGTGGGTGG + Intergenic
1050386488 9:5096492-5096514 CCATGTGGGGGGAGGGTGGTAGG + Intronic
1050727856 9:8672839-8672861 CTCTGTGTGGGGGGGGTGGGTGG + Intronic
1051286951 9:15507404-15507426 CTCTGGGAGGGCAAGGTGGATGG + Intronic
1051331889 9:16032137-16032159 CTGTGAGGGAGGAAGGTGGCAGG + Intronic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1052102279 9:24463222-24463244 ATCTGTGGGGGGAAAGGGGAAGG - Intergenic
1052492653 9:29188838-29188860 CTGTCTGGGAGGAAGGTGGCGGG - Intergenic
1053002780 9:34586388-34586410 ATCTGTGGGGAGAAAGTAGCTGG - Intronic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1056142786 9:83699586-83699608 CTTTGCGGGGCCAAGGTGGCAGG - Intronic
1056228938 9:84525802-84525824 CTCAGAGGGGGGGATGTGGCAGG + Intergenic
1057082219 9:92181441-92181463 CTCTGTGAGGAGAAGGGGCCAGG + Intergenic
1057825819 9:98371316-98371338 CCCAGTAGGGTGAAGGTGGCAGG + Intronic
1057967667 9:99519818-99519840 GTCTGTGGGAGGAAGATTGCTGG - Intergenic
1058179272 9:101777655-101777677 CATTGTTGGGGGAAGGTGGTGGG - Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1059859702 9:118446335-118446357 TTCTGTGGGGGGAAGCCAGCTGG - Intergenic
1060238548 9:121884146-121884168 CTCTGGGAGGGGGAGGTGGATGG - Intronic
1060555909 9:124507117-124507139 CTCTGGGCAGGGAAGGTGCCAGG - Intronic
1060766881 9:126300831-126300853 GTCTGTGGGTGGGAGGTAGCCGG + Intergenic
1060974247 9:127755187-127755209 CGGTGTGGGGGGGCGGTGGCCGG + Intronic
1061202214 9:129144383-129144405 CGCTGTGTGGGGAAGGGGACAGG + Intronic
1061505983 9:131032161-131032183 CTCTGTGGGCGGCAGGTAGGAGG + Exonic
1062079860 9:134618114-134618136 CTCCCTGGGGGAAAGGAGGCTGG - Intergenic
1062263001 9:135672135-135672157 CTCTGAAGGGGGAAGGGGCCAGG - Intergenic
1062271694 9:135712790-135712812 CTCTGTGGGGGGAACAAGGCAGG + Intronic
1062479353 9:136744286-136744308 CTCTCTTGGGGGAAGGGGGTGGG - Intronic
1062586300 9:137251458-137251480 CAGTGTGGGGGGCAGGTTGCTGG + Intronic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1062716271 9:138011757-138011779 CTCTGTGGAGGGAAATTCGCAGG + Intronic
1186530488 X:10290476-10290498 CTCACTGGGAGGAAGGTGGGTGG + Intergenic
1186747205 X:12582513-12582535 CCCTGTGGGAGGAGGGAGGCAGG + Intronic
1187323911 X:18268617-18268639 CTCGGTGGGGGGAGGGAGGAGGG + Intronic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1188721346 X:33527227-33527249 ATCGGTGGGTGGAAGGTGGGAGG + Intergenic
1188765856 X:34089637-34089659 TCCTCTGGGAGGAAGGTGGCTGG - Intergenic
1189131071 X:38498604-38498626 CTCAGTTGGGCCAAGGTGGCTGG - Intronic
1189332878 X:40153926-40153948 CGCCGTGGGGGGCAGGGGGCGGG + Intronic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1190117728 X:47637113-47637135 GTCTGTGGGGAGAGGGTGGTCGG + Exonic
1190708937 X:53051311-53051333 CTCTGTGGGGGCAGGGAGGGGGG + Intronic
1190735045 X:53250571-53250593 CACTGTTGGGGGCTGGTGGCAGG + Exonic
1190736138 X:53256833-53256855 CTCAGCTGGGGGAAGGGGGCAGG + Intronic
1192178801 X:68902636-68902658 CTCTGGGGGAGGATGGTGGGTGG + Intergenic
1192347362 X:70322077-70322099 CTTTGGGGGGGGAGGGTGACAGG - Intronic
1193894304 X:87093210-87093232 ACCAGTGGGGGGAAGGTGGGAGG - Intergenic
1193964850 X:87972822-87972844 CTCTGCGAGGGGGAAGTGGCAGG - Intergenic
1194001341 X:88433350-88433372 CTCTGTGCAGGGACGGTGGGAGG - Intergenic
1194123714 X:89989647-89989669 TTCTCTGGGAGAAAGGTGGCTGG + Intergenic
1195260745 X:103129275-103129297 CTTTGTGGGGCCAAGGTGGGAGG - Intergenic
1195693860 X:107652201-107652223 CTCTGTGAGGCCAAGGTGGGCGG - Intergenic
1195721630 X:107874208-107874230 TCCTCTGGGAGGAAGGTGGCTGG + Intronic
1197050141 X:122047343-122047365 CTCGGTGGGGGGAGGGGGGCGGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198341279 X:135715850-135715872 ATCTGTTGGGGGAGGGGGGCTGG - Intronic
1198607401 X:138356560-138356582 ACCTGTCTGGGGAAGGTGGCAGG + Intergenic
1198794210 X:140378476-140378498 CTCTGTGGTGGGAAGGCAGGGGG + Intergenic
1199125269 X:144110946-144110968 ATCGGAGGGTGGAAGGTGGCAGG + Intergenic
1200081810 X:153580696-153580718 CTGTGTGGTGGGCAGGGGGCTGG + Exonic
1200257185 X:154589428-154589450 CTCAGTAAGGGGAATGTGGCAGG - Intergenic
1200260585 X:154614974-154614996 CTCAGTAAGGGGAATGTGGCAGG + Intergenic
1200476600 Y:3647268-3647290 TTCTCTGGGAGGAAGGTGGCTGG + Intergenic
1201337270 Y:12894362-12894384 TCCTCTGGGAGGAAGGTGGCAGG - Intergenic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic
1201648705 Y:16262932-16262954 TTCTCTGGGGGAAAAGTGGCAGG + Intergenic
1201654104 Y:16322368-16322390 TTCTCTGGGGGAAAAGTGGCAGG - Intergenic