ID: 1067727073

View in Genome Browser
Species Human (GRCh38)
Location 10:48778506-48778528
Sequence AGCCCAGGTGCAGCACCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 230}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067727073_1067727076 19 Left 1067727073 10:48778506-48778528 CCAGTAGGTGCTGCACCTGGGCT 0: 1
1: 0
2: 1
3: 21
4: 230
Right 1067727076 10:48778548-48778570 TCTGAACATGCATGCTCAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 142
1067727073_1067727077 20 Left 1067727073 10:48778506-48778528 CCAGTAGGTGCTGCACCTGGGCT 0: 1
1: 0
2: 1
3: 21
4: 230
Right 1067727077 10:48778549-48778571 CTGAACATGCATGCTCAGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067727073 Original CRISPR AGCCCAGGTGCAGCACCTAC TGG (reversed) Intronic
900606508 1:3525954-3525976 AGCCCAGGGGCTGCACACACAGG - Intronic
900671540 1:3857681-3857703 AGCCCTTGCGCAGCACCTCCTGG - Exonic
901302716 1:8211250-8211272 AGCCCAGGTGGAGCAGCCTCGGG + Intergenic
903882672 1:26522237-26522259 AGCCCAGCTGCAATACTTACTGG + Intergenic
903976764 1:27155056-27155078 GGCCCAGCTGCAGCTCCTCCTGG + Intronic
906688765 1:47779137-47779159 TGCACAGGCTCAGCACCTACTGG + Intronic
907682539 1:56578325-56578347 AGCCCGGGGAAAGCACCTACAGG + Intronic
909759313 1:79269541-79269563 AGCCCCGGTGCAGGATCCACTGG + Intergenic
915073167 1:153288833-153288855 AGCTCACCTGCACCACCTACTGG + Intergenic
915104198 1:153522198-153522220 AGCCCTGGTGCAGGATCCACTGG + Intergenic
915328068 1:155091617-155091639 AGCCCAGGTGCTGCGCCACCTGG - Intergenic
915767090 1:158374095-158374117 AGCCCAGGTGCGGTATCCACTGG - Intergenic
918072151 1:181141078-181141100 AGCCCAGGTACAGCACCAGAGGG - Intergenic
920041718 1:203102233-203102255 AGCCCAGGAGCAGCATGTGCAGG - Intronic
920799357 1:209173026-209173048 AGACCAGGTGCAGCACTTCAAGG + Intergenic
922200326 1:223395053-223395075 GGACAAGGTGCAGCACCTCCGGG + Exonic
923295233 1:232588139-232588161 AGCCCTGTTGCAGCATATACTGG + Intergenic
923573895 1:235140715-235140737 AGCCCCGGTGCAGGATCCACTGG + Intronic
1067227913 10:44387172-44387194 AGCCCAGGTCTAGCACATAGTGG - Intergenic
1067727073 10:48778506-48778528 AGCCCAGGTGCAGCACCTACTGG - Intronic
1067796461 10:49325462-49325484 AGGCCAGGTGCAGCATCTGGTGG - Exonic
1069772974 10:70911120-70911142 ATCCCAGCTGCCGCACCTGCAGG + Intergenic
1070820387 10:79350777-79350799 AGCCCAGCTGAAGCATCCACAGG - Intronic
1071055762 10:81506194-81506216 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1071335781 10:84599453-84599475 ACCCCAGATTCACCACCTACTGG - Intergenic
1071717816 10:88114708-88114730 AGCCCAGGGGCAGGTCCTGCAGG - Intergenic
1071797010 10:89018593-89018615 AGCCCCGGTGCAGGATCCACGGG - Intergenic
1072508100 10:96090301-96090323 AGCCCAGCTGCAGCCGCTTCCGG - Intergenic
1072783020 10:98262863-98262885 GGCCCTGGTGCAGCACCTCCAGG + Exonic
1075117456 10:119638800-119638822 AGCCCAGGGGCAGCGCATAGTGG - Intergenic
1077778140 11:5294382-5294404 AGCCCAGGTGCGGGATCCACTGG - Intronic
1077877447 11:6320146-6320168 AGCCCAGGTGCAGCGGCTGGAGG - Exonic
1081420975 11:42874334-42874356 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1082698683 11:56401859-56401881 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1083546186 11:63550625-63550647 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1085245680 11:75098629-75098651 AGCCCCGGTGCGGGACCCACTGG + Intergenic
1086808096 11:91269177-91269199 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1088813736 11:113408073-113408095 AGCCCAGGATCACCACCTAAGGG - Intergenic
1089864814 11:121622557-121622579 AGCCCAGCTGCAGCTTCTGCGGG - Intronic
1090860435 11:130647935-130647957 AGCCTAGGTGAAACACCGACAGG + Intergenic
1092137505 12:6159896-6159918 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1092583759 12:9876110-9876132 AGCCCAGGTGCGGGATCCACTGG - Intergenic
1094232540 12:28123495-28123517 AGGCCAGGAGTATCACCTACAGG - Intergenic
1094489752 12:30952278-30952300 AGACCAGGTGCAGCGTCTCCTGG - Intronic
1101200655 12:102432556-102432578 AGCCAAGGTGGAGCACAGACAGG + Intronic
1101213290 12:102556196-102556218 GGCCCAGCTGCAGCACTTATTGG + Intergenic
1101348912 12:103910025-103910047 GTCCCAGGTTCAGAACCTACTGG - Intergenic
1102387177 12:112519871-112519893 AGCCCTGGTGCAGGATCTACTGG - Intergenic
1103001699 12:117389773-117389795 AGACCAGCTCCACCACCTACTGG - Intronic
1103004234 12:117408719-117408741 AGCCCAGGTGCAACCCATCCCGG + Intronic
1105876609 13:24560645-24560667 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1109563093 13:64077474-64077496 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1109745892 13:66622370-66622392 AGCCCCGGTGCAGGAGCCACTGG + Intronic
1110744765 13:79039367-79039389 ACCCCAAGTTCATCACCTACAGG - Intergenic
1112077665 13:95931360-95931382 AGCCCAGGGGCTTCACCTAGTGG + Intronic
1113105937 13:106771630-106771652 AGCCCTGGTGTAGCACCTTGGGG + Intergenic
1113403486 13:110017480-110017502 AGCGCACGTGCAGCACCAGCTGG - Intergenic
1116223117 14:42113432-42113454 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1117033915 14:51706666-51706688 AGCCCAGGTGTCGCTCCTTCTGG + Intronic
1117034308 14:51711844-51711866 AGCCCAGGTTCATCACTAACAGG + Intronic
1119564621 14:75618059-75618081 AGCCCATGTGCAGAACCTTGTGG + Intronic
1121623955 14:95371282-95371304 AGCCCCGGGGCAGTGCCTACAGG + Intergenic
1122261234 14:100524304-100524326 AGCCAAGGCCCAGCACCTAACGG + Intronic
1122601702 14:102924846-102924868 AGGCCAAATGCAGCCCCTACGGG + Intronic
1123105782 14:105840488-105840510 AGCCCAGGAGCACCACGTTCTGG - Intergenic
1123714086 15:23013858-23013880 AGGAGAGGTGCAGCAGCTACTGG - Intronic
1126338199 15:47609922-47609944 AGCACACATGCAGCACCTAATGG - Intronic
1127765991 15:62186503-62186525 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1128280024 15:66386971-66386993 AGCCCAGCTCCAGCTCCTGCCGG - Exonic
1129373939 15:75115935-75115957 AGCCCCGGTGCAGGATCCACTGG - Intronic
1129986966 15:79926496-79926518 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1130149717 15:81302116-81302138 AGGCCTGGGGCAGCACCTAGAGG - Intronic
1130530223 15:84741516-84741538 ACCCCAGGTCTAGCATCTACTGG - Intergenic
1132376303 15:101330349-101330371 AGTCCAGGTGCAGCCTCCACTGG + Intronic
1132809656 16:1791451-1791473 GGCCCAGCTGCAGCTCCTCCAGG + Exonic
1132944351 16:2524371-2524393 AGCCAAGGTGAGGCACCTCCAGG + Intronic
1135280934 16:21153019-21153041 AGCCCCGGTGCAGGAGCCACTGG + Intronic
1135494825 16:22942286-22942308 AGCCCAGGGGAAGCAACTCCTGG + Intergenic
1135592172 16:23712626-23712648 ACCCCAGGTTCAGAACCTATGGG - Intronic
1135832652 16:25789712-25789734 AGCACAGGTGGAGGACCTTCTGG - Intronic
1136046378 16:27618346-27618368 AGTGCAGGTGCAGCACACACCGG - Intronic
1138216869 16:55212240-55212262 ATCCCAGTTGCAGCAACAACTGG - Intergenic
1138245364 16:55463172-55463194 AGCCCAGGCACAGCAACTGCGGG - Intronic
1139600358 16:67982644-67982666 GGCCCCGGTGCAGCATCCACTGG + Intergenic
1140041357 16:71410371-71410393 GGCCCAGGTGCAGCTCTGACAGG + Intergenic
1143373010 17:6451942-6451964 AGCCCAGGTGCAGCCCCGGGAGG - Exonic
1144519099 17:15942612-15942634 AGCCCAGGCCCAGCAGCTGCAGG + Intergenic
1144957120 17:19024355-19024377 AGACCAGGTGCAGCACTTCAAGG - Exonic
1145246881 17:21275430-21275452 CCCCCGGGTGCAGCAGCTACGGG - Intergenic
1147999603 17:44380085-44380107 AGCCCAGCAGCAGCACCCGCCGG + Exonic
1148016950 17:44528395-44528417 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1152773967 17:82188337-82188359 AGCCCACGTGGAGCAGCTGCAGG - Exonic
1152798241 17:82318295-82318317 TGCTCATGTGCTGCACCTACTGG - Intergenic
1155437262 18:25826375-25826397 AGCCTGGGTGCAACACCTAGAGG + Intergenic
1157295479 18:46439072-46439094 AGCCCAGGTCCAGCTGCTACGGG - Intronic
1160037842 18:75317979-75318001 GGCTCCGATGCAGCACCTACCGG - Intergenic
1162107073 19:8376186-8376208 AGCCCCGGTGCAGGATCCACTGG + Intronic
1162230220 19:9259935-9259957 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1162362977 19:10230777-10230799 AGCCAAGGGGCGGCACCCACGGG - Intronic
1162632628 19:11941234-11941256 AGCCCTGGTGCAGGATCCACTGG - Intronic
1163429643 19:17259597-17259619 AGCCCAGATGGAGCAACTCCGGG - Exonic
1163898484 19:20080174-20080196 TGCCCAGGGGCAGCACATAATGG + Intronic
1164170242 19:22718599-22718621 AGCCCTGGTCCAGCACCCACGGG - Intergenic
1165319302 19:35075809-35075831 TGCCCAGGGCCAGCACCTCCTGG - Intergenic
1165472134 19:36009820-36009842 ATCCCAGCTGCAGCTCCCACCGG - Intronic
1167645010 19:50700852-50700874 GGGCCAGGTGCAGCTCCTTCAGG - Intronic
1167650301 19:50725026-50725048 GGCCCAGGCGCAGCCCCTTCAGG - Exonic
1168485644 19:56759926-56759948 AGCCCAGGTGCAGCAGGTGCAGG + Intergenic
928003657 2:27543754-27543776 AGCCCAGGTGCAGCAGCTTAGGG - Intronic
930411214 2:51028207-51028229 AGCCCAGGAGCAGCAGCGAGAGG + Exonic
930468156 2:51780274-51780296 AGCCCCGGTGCAGGATCCACTGG - Intergenic
933442024 2:82326222-82326244 AGCCCCGGTGCGGGACCCACTGG - Intergenic
934752615 2:96803219-96803241 ACCACAGGTGCATCACCTCCCGG - Intronic
936024368 2:109020211-109020233 AGCCCAGGAGCAGCGCACACAGG + Intergenic
936346964 2:111682272-111682294 AGCCCCGGTGCAGGATCCACTGG + Intergenic
938126005 2:128672061-128672083 AGCCCCGGTGCAGGATCCACTGG - Intergenic
942186739 2:173431425-173431447 AGCACAGGTGCAGCAGGTGCAGG + Intergenic
947412063 2:229851138-229851160 AGCCCCGGTGCAGGATCCACTGG + Intronic
947476932 2:230458667-230458689 AGCCCAGGTGAAAGACCTTCAGG + Intronic
947539968 2:230969598-230969620 AGCCCAGTTGCAGAATCTTCTGG - Intergenic
948363309 2:237437733-237437755 TGGACAGGTGCAGCACCCACCGG - Intergenic
948609859 2:239159860-239159882 AGCCGAGGTGCAGCCCCCACGGG + Intronic
1171187981 20:23137046-23137068 CGCCCTGGTGCAGCCCCTCCAGG - Intergenic
1172385153 20:34529036-34529058 AGCCCAGGGGCTGCTCCCACAGG + Intronic
1172697351 20:36831802-36831824 AGCCCAGTTCCAGCATTTACTGG + Intronic
1173421838 20:42908075-42908097 AGCGCAGTTGCAGCTCCTAATGG - Intronic
1174840646 20:53898438-53898460 AGCTCCGGTGCAGCACTTGCTGG - Intergenic
1176234074 20:64046118-64046140 GCCCCAGGTGCAGCCCCTACTGG + Intronic
1178327066 21:31654607-31654629 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1180917126 22:19497085-19497107 AGCCCGGGTGCAGCACTGGCTGG - Intronic
1181104295 22:20564448-20564470 AGCCCAGCTGCAGCTCCAGCAGG + Exonic
1183359292 22:37375201-37375223 AGCCCAGCTGCAGGACCTGCAGG + Exonic
1184033246 22:41906885-41906907 TCCCCAGGTGCAGCACCTCCCGG + Exonic
1184409097 22:44316356-44316378 AGCCCTGGTGCAGCCACTTCCGG - Intergenic
1185244520 22:49765967-49765989 GGCTCAGGTGCAGCTGCTACAGG - Intergenic
949508469 3:4748069-4748091 AGCCCAGATAGAGTACCTACTGG - Intronic
950447318 3:13045763-13045785 AGGCCAGGCTCAGCCCCTACAGG + Intronic
950797649 3:15523214-15523236 ATCCCAGATGCAGCATCAACAGG + Intergenic
952226853 3:31386512-31386534 AGCCCAGGTGCAGCCCTCAGGGG - Intergenic
953491800 3:43359294-43359316 TGGCCAGGTGCAGAACCCACAGG - Intronic
956195814 3:66651949-66651971 AGCCCCGGTGCAGGATCCACTGG + Intergenic
956260051 3:67329466-67329488 AGCCAATGGGCAGCACCAACAGG + Intergenic
962804308 3:138915947-138915969 AACCCTGGTGCAGGACCTAGGGG - Intergenic
963589917 3:147245543-147245565 AGCCCCGGTGCAGGATCCACTGG - Intergenic
963742847 3:149097659-149097681 AGCCCAGGTGCAGGATCCACTGG - Intergenic
963744229 3:149109778-149109800 AGCCCGGGTGCAGGATCCACTGG + Intergenic
965165951 3:165194802-165194824 AGCCCAGGTCCAGAACGTAAGGG - Intronic
965605269 3:170492188-170492210 AGCACATGTGCAGTACCTAGGGG + Intronic
966190938 3:177271666-177271688 AGCCCCGGTGCAGGATCCACTGG - Intergenic
967499077 3:190176987-190177009 AGCCCCGGTGCAGGATCCACTGG - Intergenic
968074847 3:195810631-195810653 AGCCCACGGCCAGCACCTCCCGG + Intronic
969216024 4:5723134-5723156 TCCCCAGGTGCTGCGCCTACAGG + Intronic
970035068 4:11723843-11723865 GGCCCAGGAGGAGCATCTACCGG - Intergenic
971905116 4:32716163-32716185 AGCCCCGGTGCAGGAGCCACTGG - Intergenic
973538768 4:51912760-51912782 AGACCACTTGCAGCACTTACCGG + Intronic
973872921 4:55184752-55184774 AGCCCAGGTGTTGCACCCACAGG - Intergenic
974484710 4:62491835-62491857 AGCCCAGGTGCAGGATCCACTGG - Intergenic
974590513 4:63942820-63942842 AGCCCAGGTGCGGGATCCACTGG - Intergenic
974981272 4:68960269-68960291 AGCCCAGCTGCAGCTCCTGAAGG - Intergenic
975696748 4:77021408-77021430 AGGCCAGGTTCACCACCTCCTGG + Intronic
976581734 4:86745040-86745062 AGCAGAGGTGCAGCAGGTACTGG - Exonic
978456421 4:108897498-108897520 AGACCAGTTCCAGCACCTACTGG + Intronic
979688669 4:123538339-123538361 AGCCCAGGTGCGGGATCCACTGG + Intergenic
980628668 4:135407041-135407063 AGCCCCGGTGCGGGATCTACTGG + Intergenic
981337316 4:143581759-143581781 AGCACAGCTGCACCACCTCCTGG + Intronic
982868727 4:160550046-160550068 AGCCCCGGTGCAGGATCCACTGG - Intergenic
984238742 4:177193134-177193156 AGCCCAGGTGCGGGATCCACCGG - Intergenic
984241767 4:177227503-177227525 AGCCCCGGTGCAGGATCCACTGG - Intergenic
984770640 4:183433567-183433589 AGCCCCGGTGCAGGATCCACTGG + Intergenic
987383935 5:17311711-17311733 AGCCCCGGTGCAGGATCCACTGG - Intergenic
988651982 5:33162525-33162547 GGCCCAGGGGCAGCACGTAGTGG - Intergenic
990948382 5:61272892-61272914 AGTCCAGGAGCAGCAGCGACAGG - Intergenic
992154275 5:73939546-73939568 AGCCTTGGTGCAGCTCCTCCAGG + Intronic
992296811 5:75334108-75334130 AGCCCTGGTGCAGGATCCACTGG + Intergenic
993192111 5:84696074-84696096 AGCCCAGGTGCTTCCCCTATAGG - Intergenic
994044351 5:95291320-95291342 CCCCCAGGTCCAGCACCTCCTGG + Intergenic
994096419 5:95851589-95851611 AGCCCAGGTGCGGGATCCACTGG + Intergenic
995568745 5:113457566-113457588 AGCCCAGGTGCAGGATCCACTGG + Intronic
997360190 5:133290106-133290128 TGCCCAGGTGCAGCACCAGCAGG + Intronic
997473458 5:134129544-134129566 AGCTCAGTTGCAGCAGCTCCCGG + Intronic
997648373 5:135496887-135496909 AGCCCAGGACCAGTACCTACAGG - Intergenic
997733905 5:136199723-136199745 AGCTCAGGAGCAGAATCTACAGG - Intergenic
999204429 5:149837859-149837881 AGCCCAAGAGCAGCATCTAGTGG - Intronic
1000328341 5:160188609-160188631 AGCCCAGGGGCGACACCTCCGGG - Intronic
1001116662 5:168946316-168946338 AGTCCTGCTGCAGGACCTACAGG + Intronic
1003845809 6:10172177-10172199 AGCCCAGGTGCGGGATCCACTGG + Intronic
1004053076 6:12108327-12108349 AGTCCTGGTGCAGGATCTACTGG - Intronic
1004233649 6:13854667-13854689 AGCACAGGTGCACAATCTACTGG - Intergenic
1004486200 6:16069138-16069160 AGCCCCTGTGCGGCATCTACTGG - Intergenic
1004501965 6:16217251-16217273 AGCCCCAGTGCAGGACCCACTGG + Intergenic
1006011346 6:31045327-31045349 AGCACAAGTGCAGCCCCTCCAGG + Intergenic
1006941836 6:37756734-37756756 ATCCCAGCTCCAGCACTTACAGG + Intergenic
1007588464 6:43007160-43007182 AGCCCAGGTGGAGCTCTAACTGG + Intronic
1007738801 6:43998479-43998501 AGCCCTGGTGCAGGATCCACTGG + Intergenic
1009407037 6:63326388-63326410 AGCCCTGGTGCAGAATCCACTGG - Intergenic
1009736834 6:67687550-67687572 AGCCCAGCTGCAGCCCCTGAAGG - Intergenic
1009899003 6:69788880-69788902 ATCCCAGCTTCAGCACTTACAGG + Intronic
1011620027 6:89234426-89234448 AGCCCTGGTGCAGGATCCACTGG - Intergenic
1012578155 6:100829169-100829191 AGCCCAGGTGCGGGATCCACTGG - Intronic
1013080302 6:106806179-106806201 AGCCCCGGTGCGGGACCCACTGG + Intergenic
1013410710 6:109881083-109881105 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1014507837 6:122281003-122281025 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1014788549 6:125644876-125644898 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1016067294 6:139697861-139697883 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1016217278 6:141618637-141618659 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1016987286 6:149904996-149905018 AGTCCATGTGCAGCACCCAGAGG - Intergenic
1019577590 7:1744923-1744945 AGCCCAGCTGCAGCACCTGCAGG - Exonic
1024345692 7:48310803-48310825 AGCCCAGGCCCAGCACTTTCCGG + Intronic
1024741843 7:52363030-52363052 AGCCCAGGTGCGGGACCCACTGG + Intergenic
1026257151 7:68722287-68722309 TGCCCAGGTGCAGCGTTTACAGG + Intergenic
1026512417 7:71038018-71038040 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1028785011 7:94782917-94782939 GCACCAGGTGCAGCACCTACTGG + Intergenic
1030091645 7:105863465-105863487 TGCCCAGGTGCAACACTTAAGGG + Intronic
1030366948 7:108657187-108657209 AGCCCCAGTGCAGCATCCACTGG - Intergenic
1032709237 7:134447964-134447986 AGCCCAGGTACAGCCACTTCAGG - Exonic
1034383694 7:150720598-150720620 AGCCCAGGTGGAGCAGCTGCTGG + Exonic
1034516260 7:151582626-151582648 AGCTAAGGTGCTACACCTACTGG + Intronic
1034994768 7:155570815-155570837 GGCCCAGGTGCAGCACCACAGGG - Intergenic
1036915051 8:12796686-12796708 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1037483226 8:19324503-19324525 AGCACAGGGGCATCACCTGCTGG + Intronic
1043701193 8:83290773-83290795 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1043939828 8:86184960-86184982 TGCCCAGCTGCTGCACCAACTGG - Intergenic
1044075896 8:87821257-87821279 AGCCCCGGTGCAGGATCCACTGG + Intergenic
1044404958 8:91816744-91816766 AGCCCAGGTGCGGGATCCACTGG + Intergenic
1044880596 8:96719024-96719046 AGCCCCGGTGCGGGATCTACTGG - Intronic
1048848243 8:138619991-138620013 AGGTCAGCTGCAGTACCTACTGG + Intronic
1049657714 8:143806072-143806094 AGCCCAGGAGCGGCCCCTCCTGG + Intronic
1049684776 8:143934914-143934936 AGCGCAGCTGCAGCTCCTGCGGG + Exonic
1051092390 9:13424984-13425006 ACCCCACCTCCAGCACCTACCGG - Intergenic
1052075520 9:24135489-24135511 AGCCCCGGTGCAGGACCCACTGG + Intergenic
1053126590 9:35585836-35585858 AGCCCAGTTGGAGCACAAACAGG - Intergenic
1053174440 9:35911908-35911930 AGCCCAGGTCCAGGAGCTCCTGG + Intergenic
1053362794 9:37501286-37501308 AGCCCAGGGGCAGGGCCTGCGGG - Intronic
1053444293 9:38139899-38139921 AGCCTGGGTGCAGCACTTAGTGG + Intergenic
1054841455 9:69745681-69745703 AGCCCAGCTCCATCACTTACTGG + Intronic
1057139387 9:92717518-92717540 AGCTGAGGTGCAGCAGCTAGGGG + Intronic
1057181803 9:93034648-93034670 TCCCCAGGTGCTGCACCTGCAGG + Exonic
1058174796 9:101724053-101724075 AGCCCCGGTGCAGGATCCACTGG - Intronic
1060727851 9:126017591-126017613 ATCCCAGGAGCAGAACCTCCTGG - Intergenic
1061392898 9:130327580-130327602 AGCCCAGGAGCAGCACCCTATGG - Intronic
1061931079 9:133833573-133833595 AGCCCAGGTCCCTCACCTGCAGG + Intronic
1187012368 X:15293197-15293219 AGGCCAGGTGCACCTCCAACTGG + Exonic
1189963758 X:46350713-46350735 ACCCCAGGTGCAGCTCCCATGGG - Intergenic
1190045797 X:47110942-47110964 AGCCCAGGTGCGGGATCCACTGG - Intergenic
1190413895 X:50163270-50163292 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1191174495 X:57484859-57484881 AACCCAGGTCCAGCCCCTTCAGG - Intronic
1194976584 X:100402667-100402689 AGCCCAGGGGCAGCGTCTGCTGG + Exonic
1198300056 X:135325876-135325898 AGCCCCGGTGCAGGATCCACTGG + Intronic
1199831727 X:151555130-151555152 AGCCCCGGTGCAGGATCCACTGG - Intergenic
1199932735 X:152540759-152540781 CCTCCAGGTGCAGCACCTTCAGG - Intergenic
1200062566 X:153490087-153490109 AGCCCAGGAGCAGCACCAGGAGG - Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1201609410 Y:15823900-15823922 ATCCCTGGTGCAGAACTTACTGG - Intergenic