ID: 1067727251

View in Genome Browser
Species Human (GRCh38)
Location 10:48779550-48779572
Sequence CTCCACAGAGACTCCATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067727251_1067727258 17 Left 1067727251 10:48779550-48779572 CCTACAATGGAGTCTCTGTGGAG 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1067727258 10:48779590-48779612 AGACCTGAAGCCTGGCTTCTGGG No data
1067727251_1067727256 9 Left 1067727251 10:48779550-48779572 CCTACAATGGAGTCTCTGTGGAG 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1067727256 10:48779582-48779604 CTTGGGATAGACCTGAAGCCTGG No data
1067727251_1067727254 -8 Left 1067727251 10:48779550-48779572 CCTACAATGGAGTCTCTGTGGAG 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1067727254 10:48779565-48779587 CTGTGGAGGTAGTCTACCTTGGG No data
1067727251_1067727257 16 Left 1067727251 10:48779550-48779572 CCTACAATGGAGTCTCTGTGGAG 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1067727257 10:48779589-48779611 TAGACCTGAAGCCTGGCTTCTGG No data
1067727251_1067727253 -9 Left 1067727251 10:48779550-48779572 CCTACAATGGAGTCTCTGTGGAG 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1067727253 10:48779564-48779586 TCTGTGGAGGTAGTCTACCTTGG No data
1067727251_1067727261 29 Left 1067727251 10:48779550-48779572 CCTACAATGGAGTCTCTGTGGAG 0: 1
1: 0
2: 1
3: 14
4: 143
Right 1067727261 10:48779602-48779624 TGGCTTCTGGGTTTGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067727251 Original CRISPR CTCCACAGAGACTCCATTGT AGG (reversed) Intronic
900340876 1:2188517-2188539 CTCCCCAGGGTCTCCATTATGGG + Intronic
901916600 1:12505066-12505088 CTCCAAGGAGACTCCAAAGTTGG - Intronic
902248581 1:15138298-15138320 TCCCACAGAGCCTCCATGGTTGG + Intergenic
903304966 1:22406876-22406898 CTCCACAGAGCTGCCCTTGTGGG + Intergenic
903369849 1:22828233-22828255 CTCCTCAGGGACTGCAGTGTGGG + Intronic
903543957 1:24112043-24112065 CTCCCCAGAGACTCCTAAGTGGG - Exonic
904142501 1:28364743-28364765 TGCCACAGAAACTCTATTGTAGG - Intergenic
904769647 1:32873650-32873672 CTCCACAGAGACCCCCTTGAGGG + Intergenic
905420721 1:37841628-37841650 CTGCACAGAGACTCTGGTGTGGG - Intronic
908729232 1:67208762-67208784 CTCCACACAGAGTCCCTAGTGGG + Intronic
910458676 1:87425253-87425275 CTGCACAGAGGCACAATTGTGGG - Intergenic
911862809 1:102975610-102975632 CATTACAGTGACTCCATTGTTGG + Intronic
911980922 1:104564888-104564910 CTTCAAAGAGACTCTCTTGTTGG - Intergenic
911982423 1:104583535-104583557 CCCCACAAAGAGTCCCTTGTGGG - Intergenic
917029386 1:170672154-170672176 CTCCACTGATCCTCCATTTTTGG + Intronic
917265940 1:173220985-173221007 CTCCACAGAGAGGCCTTTGATGG - Intergenic
919242744 1:194936032-194936054 CCCCACAGAGAGTCCCTAGTGGG + Intergenic
923461474 1:234213196-234213218 CTCCACAGAGCTACCCTTGTGGG + Intronic
1067727251 10:48779550-48779572 CTCCACAGAGACTCCATTGTAGG - Intronic
1069535127 10:69247619-69247641 CTCCAGGGAGACTCATTTGTGGG - Intronic
1073004606 10:100313624-100313646 CTCCAGAGAGAATCGATTATTGG - Intronic
1073744816 10:106455754-106455776 CTGCACAGACACTCTAGTGTGGG - Intergenic
1074886364 10:117696798-117696820 ATCCCCAGAGACTCCCTTGGAGG - Intergenic
1076210570 10:128640681-128640703 ATCAACAGAGACTTTATTGTTGG + Intergenic
1076539526 10:131205473-131205495 TTCCACAGAGAAATCATTGTGGG - Intronic
1077321016 11:1942019-1942041 CTCAACAGTGCCTCCATTCTAGG - Intergenic
1078524869 11:12092614-12092636 CCCCTCAGAGACACCAGTGTTGG + Intergenic
1079154958 11:17937766-17937788 CTCCCCAAAGATTCCATTTTAGG - Intronic
1079527711 11:21410756-21410778 CACCACAGAGACTTCATGGCAGG - Intronic
1081442424 11:43094880-43094902 CTCCACATAGTTACCATTGTGGG - Intergenic
1084098910 11:66932454-66932476 TTCCACAGAGACCCCTTGGTTGG + Intronic
1084330441 11:68426837-68426859 CTCCACAGAGCCTCCGCTGAGGG - Intronic
1089256958 11:117199214-117199236 CTCCACACAGGCTCCATATTTGG - Intergenic
1091263239 11:134250482-134250504 CTCCACAGAGACACTTTTGCTGG + Intronic
1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG + Exonic
1094049123 12:26199393-26199415 CTCCACAGTGACTCCATTCTGGG - Intronic
1097351848 12:58557189-58557211 CTCCACAGAGAATGCATGGTTGG + Intronic
1099668471 12:85660266-85660288 CTCCACACAGAGTCCCTTCTGGG + Intergenic
1100728281 12:97434105-97434127 CCCCACGGAGACTCCACTGAGGG - Intergenic
1101330851 12:103756775-103756797 GTGGACAGAGACTCCATTTTGGG - Intronic
1104169034 12:126261893-126261915 CTCCACAGGGAGACCACTGTGGG + Intergenic
1104252387 12:127107744-127107766 CTCCACGGAGAATGTATTGTGGG - Intergenic
1106690270 13:32107644-32107666 CTCCAACGAGACTCCAGTGGTGG - Intronic
1107234589 13:38153335-38153357 CCCCACAGAGAGTCCATACTGGG - Intergenic
1107715679 13:43197205-43197227 CTGCAAAGAGAATACATTGTAGG - Intergenic
1107730137 13:43340366-43340388 CTCCTCAGAGTCTCCATTGCTGG + Intronic
1107806504 13:44158494-44158516 GTCAACAGAGAAGCCATTGTTGG + Intronic
1108756857 13:53513477-53513499 CTCCGCAGAGACAACACTGTTGG - Intergenic
1118598040 14:67451281-67451303 CTCCACAGAGAGTCCCTACTGGG + Intronic
1119403088 14:74377756-74377778 CTGCACCGAGACTCTAGTGTGGG + Intergenic
1121045578 14:90785275-90785297 ATCCTCTGAGACTCCATTTTTGG - Intronic
1121094277 14:91205054-91205076 CTCCACAGAGCTCCCATTCTAGG + Intronic
1202945877 14_KI270726v1_random:26413-26435 CTTCACAGAGTCTGCATAGTAGG - Intergenic
1123874466 15:24609736-24609758 CTCCACACAGAATGCATTCTTGG - Intergenic
1125535229 15:40438522-40438544 CCCCTCAGAGCCTCCAGTGTGGG - Intergenic
1127734913 15:61831227-61831249 CCCCACAGGGACCCCAGTGTGGG + Intergenic
1131354601 15:91733893-91733915 CTCCACAGGGATTCTACTGTTGG - Intergenic
1131454334 15:92571390-92571412 CTCCACGAAGACTCCAGTCTTGG - Intergenic
1131454344 15:92571469-92571491 CTCCACAAAGACTCCAGTCTTGG - Intergenic
1140688464 16:77456972-77456994 CTCACCAGAGTCTCCAATGTGGG - Intergenic
1141452668 16:84116422-84116444 CTCCAGACAGACTCAATTCTAGG - Intronic
1148452818 17:47791119-47791141 CACTACAGTGACTCCATTGTGGG - Intergenic
1151967235 17:77437749-77437771 CTCCCCAGAAACTCCATCCTTGG - Intronic
1156467592 18:37357551-37357573 CTCCACAGAGAATCCCTACTGGG + Intronic
1157183593 18:45519427-45519449 ATTCACAGAGTCTCCAGTGTTGG + Intronic
1157331967 18:46710738-46710760 CCCCACAGAGGCTCCCCTGTTGG + Intronic
1158073484 18:53500904-53500926 CTCCACACATACTACATTATGGG + Intronic
1158181266 18:54717128-54717150 CTTCACAGATACTACATTGCAGG + Intergenic
1161964769 19:7541790-7541812 CCCCACAGGGACTCCATAGCGGG + Intronic
1162674086 19:12285130-12285152 CTGCACAGAGACTCTGGTGTGGG - Intronic
1165380580 19:35476653-35476675 CTCCACAGTGCCGCCATTGTTGG + Intergenic
1167594970 19:50422734-50422756 CAGCACAGAGAGGCCATTGTAGG - Intronic
927893931 2:26769382-26769404 CTCCACAGACACTGTATTCTAGG - Intronic
927974663 2:27329141-27329163 AGCCACAGTGACACCATTGTAGG + Exonic
928342437 2:30456381-30456403 CTCCACAGATACTCCCTGGCAGG + Intronic
929319527 2:40526112-40526134 CTCCACTGATACTCCCTAGTGGG + Intronic
930022908 2:47012194-47012216 CTGCACAGAGGCCCCATTGCTGG - Intronic
930503674 2:52255590-52255612 CCCCACAGAGAGTCCCTAGTAGG - Intergenic
931080288 2:58761573-58761595 CTCCAAAGACATTCCAGTGTGGG - Intergenic
937462999 2:122105353-122105375 CTCCACAGAGATTCCAAGGCTGG - Intergenic
941005847 2:160246138-160246160 CTCAACAGTGACTCCACTGAGGG + Intronic
943847175 2:192666109-192666131 CCCCACAGAGAATAAATTGTAGG - Intergenic
946217925 2:218200231-218200253 CTCGAGAGAGACTCCCTTGCTGG + Intergenic
947276267 2:228395852-228395874 CTCCACAGAGACTCCCTACTGGG - Intergenic
947457542 2:230269093-230269115 CTCCACAAAGCCTGCATTGATGG - Intronic
947885253 2:233564311-233564333 CTCCACAGTGTCTCCATATTAGG - Intronic
948710371 2:239821504-239821526 CTCCACAGACACTCCTGTGCTGG - Intergenic
1171424667 20:25042091-25042113 GTCCACAGAGACCTCTTTGTTGG - Intronic
1174076299 20:47939743-47939765 CTCCCCAGATACTGCATTGAAGG - Intergenic
1174745811 20:53061312-53061334 CGTCAGAGAGAGTCCATTGTAGG + Intronic
1177730782 21:25024902-25024924 GTGCATAGAGACTCCATTGTTGG + Intergenic
1181459199 22:23076327-23076349 CTCCACAGCGACTCCCTGGGTGG - Intronic
1182288257 22:29260441-29260463 CTCCCCAGGGACTCCGATGTGGG - Exonic
1183152307 22:36047468-36047490 CTCCACAGAGCCCCCAGTCTGGG - Intergenic
956348840 3:68311835-68311857 CTCCACACAGAGTCCCTAGTGGG - Intronic
956683077 3:71799543-71799565 GTCCACAGAGACTCAATCCTTGG - Intergenic
958650567 3:96931423-96931445 CCCCCCAGGGACTCCATTTTAGG + Intronic
958745317 3:98127189-98127211 CACCACAGAGACTCCCAAGTGGG - Intergenic
959615929 3:108347348-108347370 GTCCTCAGAGACTCAATTTTTGG + Intronic
961816632 3:129554222-129554244 CTCCACACAGAAGCCACTGTAGG + Intergenic
962418998 3:135210875-135210897 CTCTACAGAGAATCCTTTGCTGG - Intronic
965465252 3:169021700-169021722 CCCCAAATAGACTGCATTGTCGG + Intergenic
965603900 3:170481123-170481145 CTACACAGAGACACCAGTGGTGG - Exonic
968791924 4:2671074-2671096 ATCCACAGGGGCTCCATTGTTGG + Intronic
969675323 4:8611302-8611324 GTCCACAGATCCTCCTTTGTGGG - Intronic
971624799 4:28905573-28905595 CTCCACAGAAAGTCCAATCTAGG - Intergenic
976606879 4:86991738-86991760 CACCACAGAGACTTTAGTGTTGG + Intronic
976999980 4:91485291-91485313 CTCCAAAAAGACTCAAATGTCGG + Intronic
977174966 4:93808731-93808753 GTCCACAGAGAACCCATTCTTGG + Intergenic
979514204 4:121588345-121588367 TTCTACAGAGCATCCATTGTGGG - Intergenic
979564964 4:122145019-122145041 ACACACAGAGACTCCATTTTGGG - Intergenic
984774297 4:183467268-183467290 CTCCACACAGACTCCCTCCTGGG + Intergenic
984930400 4:184842090-184842112 TTCCACAGAGACACCACTGTGGG - Intergenic
985338949 4:188927306-188927328 CTCCTCAGAGACTTCCTTGGAGG + Intergenic
985362270 4:189188370-189188392 CTCCACCGACACTTAATTGTAGG - Intergenic
985923060 5:2994501-2994523 CTTGGCAGAGACTCCATTGATGG - Intergenic
989030122 5:37110163-37110185 ATCCAGTGAGACTCCATTTTAGG - Intronic
990271752 5:54149299-54149321 CTAAACAGAGACTCCAGTGAGGG + Intronic
992429234 5:76691609-76691631 CTCCACAGAGACTCAAAGGTGGG - Intronic
994234223 5:97342695-97342717 CCCCACACAGAGTCCATAGTGGG - Intergenic
994339811 5:98613258-98613280 CTCCAAAGAGACTTCCTTTTTGG + Intergenic
994703085 5:103162066-103162088 CTCCACATATTCTCCATTCTTGG + Intronic
996273431 5:121636587-121636609 CTCTACACAGACTCCCTTCTGGG - Intergenic
1000109894 5:158098440-158098462 CTTTAGAGAGACTCCATTGATGG + Intergenic
1001958175 5:175862745-175862767 GGCCAGAGAGACTCCATTCTGGG - Intronic
1003499510 6:6693050-6693072 CTCCACAGGAACTCCATTTGAGG + Intergenic
1004122627 6:12839426-12839448 CCCCACAGCGAGTCCTTTGTGGG + Intronic
1004122716 6:12840152-12840174 CCCCACAGCGAGTCCTTTGTAGG + Intronic
1004771608 6:18789319-18789341 CTCCACAGAGCATCCCCTGTTGG + Intergenic
1005895681 6:30175421-30175443 CTCCAGAGAGATTCCCTTATAGG - Intergenic
1007669333 6:43538855-43538877 CTGCACAGAGACTCTGGTGTGGG + Intronic
1008106809 6:47447911-47447933 CTCCACATAGACACAAATGTTGG - Intergenic
1009927052 6:70132684-70132706 ATCCACAGAGACTCCGATTTAGG + Intronic
1013628304 6:111959381-111959403 TTCCTCAAAGACTCCATTGTGGG + Intergenic
1020274678 7:6616882-6616904 CCCCACAGAGACACAACTGTGGG - Intronic
1021048651 7:15955134-15955156 GTCCACAGAGACTCTGTAGTGGG + Intergenic
1022834192 7:34098146-34098168 TTCCATAGAGACGCCAGTGTGGG + Intronic
1023258914 7:38338985-38339007 CTTCACAGAAACCCCATTGAGGG - Intergenic
1034292585 7:149944842-149944864 CTCCACAGAAACCACACTGTTGG - Intergenic
1034813484 7:154152050-154152072 CTCCACAGAAACCACACTGTTGG + Intronic
1036588667 8:10148017-10148039 GTCCAAAGTGACTCCATTGCGGG + Intronic
1038478580 8:27886150-27886172 CTCCACCCAGACCCCAGTGTCGG + Intronic
1039900200 8:41746214-41746236 CTCCCCAGAGACTGCTTGGTGGG + Intronic
1041109780 8:54473346-54473368 GTCCAAAGAGACTCCATATTTGG - Intergenic
1041834499 8:62196522-62196544 CTCCACAGATACCTCATTGATGG - Intergenic
1043412699 8:80015092-80015114 CTCCAGAGAGACTCAGTTATTGG + Intronic
1043507383 8:80915846-80915868 CTCCAAGGAGACTCCTTTGGTGG + Intergenic
1045378443 8:101599445-101599467 CTGCACAGAGACGCCTTTGGGGG - Intronic
1047068385 8:121313977-121313999 CTGCACAGAGACTACACAGTAGG - Intergenic
1047913269 8:129554320-129554342 GACCCCAGAGACCCCATTGTGGG + Intergenic
1048544622 8:135375112-135375134 ATTCCCAGAGACTCCACTGTTGG + Intergenic
1051383713 9:16484444-16484466 CTTCACTGAGACACCATTGTTGG + Intronic
1055312971 9:75003489-75003511 CTCAACAGAGACGACATTGCCGG + Intronic
1058834433 9:108848595-108848617 CCCCACAGAGAGTCCCTTCTGGG - Intergenic
1187613641 X:20969845-20969867 ATTTACAGAGACTCCAGTGTAGG - Intergenic
1188317627 X:28694053-28694075 CTGCACAGAGTCTCCTTTGGTGG + Intronic
1193148456 X:78101527-78101549 CTCTAGAGAGACACCCTTGTTGG - Intronic
1194377274 X:93151717-93151739 CTCCACAGAGAGTCCCTACTGGG - Intergenic
1202133790 Y:21639227-21639249 CTCCACATTTACTCCATGGTGGG + Intergenic