ID: 1067727569

View in Genome Browser
Species Human (GRCh38)
Location 10:48782134-48782156
Sequence GGCTGGACTTATCATTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067727565_1067727569 1 Left 1067727565 10:48782110-48782132 CCAGAAGGTAGAGACACGGAACA 0: 1
1: 0
2: 0
3: 38
4: 1161
Right 1067727569 10:48782134-48782156 GGCTGGACTTATCATTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067727569 Original CRISPR GGCTGGACTTATCATTAGAG AGG Intronic
No off target data available for this crispr