ID: 1067731638

View in Genome Browser
Species Human (GRCh38)
Location 10:48817084-48817106
Sequence CTCAATTGGACACTAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067731633_1067731638 8 Left 1067731633 10:48817053-48817075 CCTTACAACGTCTGCACATATTA 0: 1
1: 0
2: 1
3: 2
4: 76
Right 1067731638 10:48817084-48817106 CTCAATTGGACACTAGTGTCTGG 0: 1
1: 0
2: 2
3: 5
4: 57
1067731632_1067731638 9 Left 1067731632 10:48817052-48817074 CCCTTACAACGTCTGCACATATT 0: 1
1: 0
2: 1
3: 13
4: 99
Right 1067731638 10:48817084-48817106 CTCAATTGGACACTAGTGTCTGG 0: 1
1: 0
2: 2
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067731638 Original CRISPR CTCAATTGGACACTAGTGTC TGG Intronic
911328043 1:96492438-96492460 GGCAATTGGACGCTGGTGTCAGG - Intergenic
915715158 1:157938575-157938597 CTCCATGGGATACTAGTATCTGG - Intergenic
1063355443 10:5394513-5394535 GTGAATTGGACAGTAGTGGCAGG + Intronic
1066628614 10:37435996-37436018 CTCTATTAGACATTATTGTCAGG + Intergenic
1067731638 10:48817084-48817106 CTCAATTGGACACTAGTGTCTGG + Intronic
1071404301 10:85315063-85315085 CTCACTTGGACAGTACAGTCAGG - Intergenic
1075306768 10:121374898-121374920 CTTATAGGGACACTAGTGTCTGG - Intergenic
1077498219 11:2896957-2896979 TCCATTTGGACACTGGTGTCAGG + Intronic
1078626883 11:12966092-12966114 CTCAAATGCACACCAGGGTCAGG + Intergenic
1079008500 11:16809689-16809711 CTCAGTTGTACCCTAGTGACGGG + Intronic
1086048631 11:82562953-82562975 CTTCAATGGACACTAGAGTCTGG + Intergenic
1086165100 11:83768881-83768903 TTCAAATGGACACCAGAGTCAGG + Intronic
1092228350 12:6763630-6763652 CTCAATTGGACTGTAGAGTAAGG + Intronic
1101470956 12:104996531-104996553 CTCAAGTGGGCCCTAATGTCTGG + Intronic
1105260119 13:18772853-18772875 ATCAATTGGACACAAATGTGGGG - Intergenic
1111277287 13:85966862-85966884 CTCCACTGGGCACTGGTGTCTGG + Intergenic
1115791795 14:36887882-36887904 CTCAGTTTGACACAAGAGTCAGG + Intronic
1118427900 14:65687357-65687379 GTTAATTGGACAGTAGTGTTAGG + Intronic
1124399850 15:29338586-29338608 CTCCATAGGGCACTGGTGTCTGG + Intronic
1124585149 15:30998227-30998249 CTCAATGGGACACTCACGTCTGG + Intergenic
1125679877 15:41523910-41523932 GTCACTTGGACACAGGTGTCTGG - Exonic
1126526627 15:49663320-49663342 CTCATGAGGACACTAGTGACAGG + Intergenic
1127328831 15:57919384-57919406 CTCAAAAGGAAACTAGTGACAGG - Intergenic
1132419742 15:101655116-101655138 CTCATTTGCACCCTAGTGCCAGG - Intronic
1132419762 15:101655230-101655252 CTCATTTGCACCCTAGTGCCAGG - Intronic
1132419786 15:101655344-101655366 CTCATTTGCACCCTAGTGCCAGG - Intronic
1132419842 15:101655686-101655708 CTCATTTGCACCCTAGTGCCAGG - Intronic
1133364520 16:5200254-5200276 CTCATCTGGACACTAGTCCCTGG + Intergenic
1134394493 16:13850876-13850898 CTCAGATGGAAATTAGTGTCTGG + Intergenic
1136924133 16:34355864-34355886 CTTATTTGGACATTAGTGTAGGG - Intergenic
1136980440 16:35055942-35055964 CTTATTTGGACATTAGTGTAGGG + Intergenic
1148404946 17:47403443-47403465 CCCAATTGTACCCTAGTGTCTGG - Intronic
1150712423 17:67543318-67543340 CCCAATGGGACACTTGTGTTTGG - Intronic
1153101729 18:1478623-1478645 CTTAACTTAACACTAGTGTCAGG - Intergenic
1153914585 18:9734255-9734277 CTCAATTGCACAATAGTGACAGG - Intronic
1167879711 19:52445764-52445786 CTCAGATGGACAGTAGTGTGTGG - Intronic
929358314 2:41052801-41052823 CTCCATTGGAAATTAGTGCCAGG - Intergenic
929432446 2:41898556-41898578 CTCAATTGGAAAGGAGTGTGAGG + Intergenic
944478406 2:200129969-200129991 CTCAGTTGGACACTGGGATCAGG - Intergenic
948387860 2:237592790-237592812 CTCACATGGACACTGGTGCCTGG - Intronic
1177388925 21:20442177-20442199 CTCAATTGGACACTGATGCAAGG - Intergenic
1180273557 22:10624731-10624753 CTGAATTGGACTCTAGTGGATGG - Intergenic
953432285 3:42850150-42850172 CTCTATTGGAAACTAGTGTTTGG + Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
963226197 3:142864382-142864404 CTCACTTGGCCACAAGTTTCAGG + Intronic
973122539 4:46540311-46540333 CTCTATTGGACAGTAGTTTAGGG + Intergenic
983056424 4:163103030-163103052 ATCAATTGGACACAATTGGCAGG + Intergenic
985479030 5:95753-95775 CTCCATTGGACACTAGAGGTGGG - Intergenic
992092201 5:73327126-73327148 TTCAAATGGACAGTAGTGACAGG + Intergenic
994210473 5:97083154-97083176 CTCATTAGGAAACTAGTTTCAGG - Intergenic
995525457 5:113047133-113047155 CCCAAGTGGACATTTGTGTCTGG + Intronic
1002388153 5:178886536-178886558 CTCAGATGGGCAGTAGTGTCAGG + Intronic
1004347162 6:14859040-14859062 CTCAGATGGAAACTAGAGTCAGG + Intergenic
1004501807 6:16216634-16216656 CTCAAATGGATACTAGAGTCTGG - Intergenic
1028958305 7:96719387-96719409 CTCAAACTGACACTAGTCTCTGG - Intergenic
1031367648 7:120922867-120922889 CTCAAATGGACAATATTGTGGGG + Intergenic
1040816813 8:51516775-51516797 CTTAATTGGTCCCTAGTGTCAGG - Intronic
1048817826 8:138350453-138350475 CTCACTGGGACACTAGAATCAGG + Intronic
1050098761 9:2096058-2096080 CACAATTGGACACTACTTTATGG - Intronic
1057900078 9:98942024-98942046 CTCAAGTGGACAATTTTGTCGGG + Intergenic
1188866436 X:35318905-35318927 CTCTATAGGACACTAGTGTCAGG - Intergenic
1192192160 X:68997577-68997599 CACATTTGGACAATAGTATCAGG + Intergenic
1193528749 X:82627353-82627375 CTCAATTGGACCCCAGTGTCTGG + Intergenic
1199090167 X:143681782-143681804 CTCAAGTAGACATCAGTGTCTGG + Intergenic
1202052107 Y:20791973-20791995 CTCATTTGGAGAGTAGTGTGGGG + Intergenic