ID: 1067732532

View in Genome Browser
Species Human (GRCh38)
Location 10:48822391-48822413
Sequence GCAGCTTCTGCACTTGGCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 1, 2: 1, 3: 36, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067732532_1067732540 27 Left 1067732532 10:48822391-48822413 CCTCAGCCAAGTGCAGAAGCTGC 0: 1
1: 1
2: 1
3: 36
4: 273
Right 1067732540 10:48822441-48822463 CTGCTTCACCCAGAAGCTGGTGG 0: 1
1: 0
2: 4
3: 37
4: 362
1067732532_1067732538 24 Left 1067732532 10:48822391-48822413 CCTCAGCCAAGTGCAGAAGCTGC 0: 1
1: 1
2: 1
3: 36
4: 273
Right 1067732538 10:48822438-48822460 CTCCTGCTTCACCCAGAAGCTGG 0: 1
1: 0
2: 5
3: 43
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067732532 Original CRISPR GCAGCTTCTGCACTTGGCTG AGG (reversed) Exonic
900138555 1:1129059-1129081 GCGGCTTCTGCTATTGGCTGGGG + Intergenic
900574383 1:3375838-3375860 GCAGGGTCTTCACTTGGGTGGGG - Intronic
900949398 1:5849427-5849449 GCTGCTTCTGCTCTGGGCAGTGG - Intergenic
901237677 1:7676217-7676239 GCAGGTTCTGGACTTGGCCGGGG + Intronic
901411375 1:9086672-9086694 TCAGCCACTGCACCTGGCTGAGG + Intronic
901828389 1:11877772-11877794 GCAGCTTATGCAGCTGCCTGCGG - Intergenic
902078415 1:13805011-13805033 GCTGCTTCTCTACTTGGCCGAGG + Intronic
902743018 1:18453333-18453355 GGAGCCACTGCTCTTGGCTGTGG + Intergenic
903302116 1:22386458-22386480 CGAGCTTCAGCACTGGGCTGGGG + Intergenic
903694108 1:25194990-25195012 GCAGCCTCTGCACCTGGCCGAGG + Intergenic
905024328 1:34839507-34839529 GCAGCTTCTGCAGTGGCCTGTGG - Intronic
905359722 1:37411014-37411036 GCTGGCTCTGCAGTTGGCTGAGG - Intergenic
905975295 1:42169864-42169886 GCAGCTTCTGGAAGTGGGTGAGG - Intergenic
906695621 1:47821433-47821455 TCAGCTACAGGACTTGGCTGTGG + Intronic
909691219 1:78409739-78409761 AGAGCTTCTGCACTGTGCTGGGG - Intronic
911087175 1:93988768-93988790 GCAACTACTCAACTTGGCTGTGG - Intergenic
913308245 1:117455522-117455544 CCAGATCCTACACTTGGCTGAGG + Intronic
914879944 1:151539525-151539547 ATGGCTTCTTCACTTGGCTGTGG - Intergenic
916025600 1:160830825-160830847 GCAGGTTCTGCACGTGGGTGGGG - Intronic
916075198 1:161196623-161196645 GCAGCTTCTGTGCCTGGCAGCGG - Exonic
916541447 1:165759258-165759280 GTGGCTTTTGAACTTGGCTGAGG - Intronic
919188220 1:194181975-194181997 GCAGCTTCTGCATTGGGCACTGG - Intergenic
920059162 1:203215804-203215826 GCAGCTTGTGCTCTGGACTGAGG + Intronic
920888351 1:209956413-209956435 GCATCTTCAGCACATGGCTTTGG + Intronic
921029726 1:211326825-211326847 GCGGCTGCTGCTCCTGGCTGCGG - Exonic
921291744 1:213664039-213664061 GCGGCATCTGCACATGGGTGAGG - Intergenic
1063670387 10:8095399-8095421 GCAGTGTCTGCACATGGCTGTGG + Intergenic
1065449115 10:25837475-25837497 GTACCTTCTGCTCTGGGCTGAGG - Intergenic
1066444645 10:35470657-35470679 GCAGTAGCAGCACTTGGCTGCGG + Intronic
1066568818 10:36749159-36749181 GCAGGTTGTGCACTGGGCTCTGG - Intergenic
1067549131 10:47221155-47221177 GCAGGCCCTGCTCTTGGCTGGGG + Intergenic
1067732532 10:48822391-48822413 GCAGCTTCTGCACTTGGCTGAGG - Exonic
1069834067 10:71297659-71297681 GCTGCATCTGCATTTGCCTGGGG + Intronic
1071598216 10:86943070-86943092 CCAGCGCCTGCACTTGGCTCCGG + Exonic
1072464493 10:95650620-95650642 GCTGCTTCTGCTCTTGGAAGAGG - Intronic
1072581040 10:96740422-96740444 GCAGCTCATGGACTTTGCTGGGG + Intergenic
1075933428 10:126319343-126319365 GGTGCTTCAGCACCTGGCTGAGG - Intronic
1076814509 10:132908165-132908187 GCTGCCTGTGCACATGGCTGAGG + Intronic
1077045135 11:541337-541359 GCTTGTGCTGCACTTGGCTGGGG - Intronic
1077798814 11:5518070-5518092 GCAGCTTCTGCACTGGAATCAGG + Intronic
1077910298 11:6567098-6567120 GCAGGTTCTGCAGTTGGCTTAGG - Exonic
1077914293 11:6601192-6601214 GCCACTTCTTCACTTGGCTCTGG + Exonic
1078050305 11:7960117-7960139 GCAGCCTTTGCACTTCTCTGCGG + Exonic
1078351463 11:10598180-10598202 TGAGCTTTTGCACTTGCCTGTGG - Intronic
1078577805 11:12516505-12516527 GCAGCCTCCGCACTTAGCTGAGG + Intronic
1078842528 11:15092059-15092081 GCAGCTTCACCTCTTGCCTGAGG + Intergenic
1081751674 11:45515569-45515591 GCACCTTCTGCACAGGGCAGTGG - Intergenic
1082793488 11:57363750-57363772 CCAGCTTCTGCACTCTCCTGTGG - Intronic
1086423284 11:86658774-86658796 GCAGCTTCTCCTCATGTCTGAGG - Intronic
1086771593 11:90774415-90774437 GGAGCTGCTGCAGTTTGCTGGGG + Intergenic
1089016002 11:115166067-115166089 CCAGATACTGCACTTGGCTTCGG + Intergenic
1089065150 11:115656977-115656999 GCGCCTTTTGCACTTGGTTGTGG - Intergenic
1089078687 11:115759457-115759479 CCAGCTTCTCCCCTTGGCTATGG - Intergenic
1089140700 11:116281643-116281665 GCAGCCTCTGCACTTGGTGCTGG + Intergenic
1089181545 11:116586679-116586701 GAAGTCTCTGCACTTGGCTTTGG + Intergenic
1090207157 11:124891703-124891725 GCAGCCTCAGCAGTCGGCTGGGG - Exonic
1090305844 11:125690260-125690282 GCAGCCTCTGCATTTGCCTTTGG - Intergenic
1090409733 11:126499510-126499532 GGAGCATCTGAATTTGGCTGTGG - Intronic
1090657494 11:128857114-128857136 GCAGCTCCTGCCCTGGGCTTCGG + Intronic
1090669528 11:128936761-128936783 GCAGCGTCATCACTTTGCTGAGG - Intronic
1091071557 11:132569066-132569088 GCAGGTTCGGCACTCGCCTGCGG + Intronic
1091410723 12:237505-237527 GCACCTCCTTCCCTTGGCTGGGG - Intronic
1091813357 12:3418163-3418185 AACTCTTCTGCACTTGGCTGGGG - Intronic
1092433921 12:8431264-8431286 GCAGTTTCTGTTCTTGGTTGTGG - Intergenic
1094480598 12:30878266-30878288 GGCTCTTCTGCAGTTGGCTGGGG + Intergenic
1098445066 12:70558007-70558029 GCAACTACTGCAGCTGGCTGTGG + Intronic
1098584409 12:72138912-72138934 GCAGCACATGAACTTGGCTGTGG + Intronic
1099021637 12:77413064-77413086 GCTGCATCTCCACTTGGCTCAGG + Intergenic
1099249099 12:80230310-80230332 GCAGCTTCTCCCCTTGTCTGAGG + Intronic
1100853622 12:98739106-98739128 CCAGCTCCACCACTTGGCTGTGG - Intronic
1101773775 12:107775539-107775561 GGAGCGTCTCCACTTTGCTGAGG - Exonic
1103724512 12:122991058-122991080 GCTGCTTCTGCTGTGGGCTGTGG - Intronic
1104847186 12:131852509-131852531 CCAGCATCTGCCCTGGGCTGTGG + Intergenic
1107238570 13:38202869-38202891 GCTGCGTCTACACTGGGCTGTGG - Intergenic
1107458358 13:40576528-40576550 GGAGCTGCTGTCCTTGGCTGTGG + Intronic
1110441902 13:75535618-75535640 GGAGCTTCTGCTCTAAGCTGTGG + Intronic
1112502153 13:99951237-99951259 TCAGCTTTCTCACTTGGCTGTGG - Intergenic
1112790889 13:103001271-103001293 GCAGCTTCTGTGCTTGCATGGGG - Intergenic
1113092976 13:106634112-106634134 GCAGCTTTTGCATCAGGCTGTGG + Intergenic
1113366610 13:109682480-109682502 CCAGCCTCTGCACAAGGCTGTGG - Intergenic
1117750247 14:58914479-58914501 GAAGCTGGTGCACTTGTCTGGGG - Intergenic
1120751442 14:88202384-88202406 GCAGCTTCTGTACTGGGAGGAGG - Intronic
1121326311 14:93021834-93021856 GCAGCCTCTGCCCCAGGCTGGGG + Intronic
1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG + Intronic
1121714823 14:96066062-96066084 GGAGCTCCTCCACGTGGCTGTGG - Intronic
1121760801 14:96443439-96443461 GCAATTTCTGCACTTCCCTGAGG + Intronic
1122089559 14:99329209-99329231 GCACCTTCTTCACATGGCAGTGG - Intergenic
1122197167 14:100097151-100097173 GCAGTCACTGCACTTTGCTGGGG - Intronic
1122362234 14:101174330-101174352 GGAGCTTGAGCACTGGGCTGGGG - Intergenic
1123014034 14:105365103-105365125 GCAGCTCCAGCCCTTTGCTGAGG + Intronic
1123124619 14:105937597-105937619 GCAGCTCCCAAACTTGGCTGAGG - Intergenic
1123945717 15:25237911-25237933 TCAGCTCCTGCACTGAGCTGGGG + Intergenic
1124653171 15:31487510-31487532 GCTGCCTCTGCACTTTGCAGTGG - Exonic
1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG + Exonic
1126959589 15:53976801-53976823 ACAGCTTCTGTACTTTGCAGTGG + Intergenic
1127908077 15:63391965-63391987 GCAGCTTCTGCTCTTGGCTATGG - Intergenic
1128522720 15:68386281-68386303 GCAGGATCTGCACTTGGCCATGG + Intronic
1129177223 15:73848669-73848691 TCTGCTCCTGCACTTGGCTCTGG - Intergenic
1129189361 15:73928175-73928197 TCGCCTTCTGCACTTGGCTTGGG + Intronic
1131932508 15:97459932-97459954 GCAGCTGCTTCCCATGGCTGAGG - Intergenic
1131965624 15:97839202-97839224 GCAGCTTCTGAACATGCCAGGGG + Intergenic
1132998500 16:2836826-2836848 GTAGCTTTTGCTGTTGGCTGAGG + Intronic
1133317164 16:4892039-4892061 GCAGCTGCTGGACTTGGCCCAGG - Exonic
1133403097 16:5503040-5503062 GCAGCTTCCACACTTGCATGGGG - Intergenic
1133800010 16:9077560-9077582 GCAGCTACTGTTCTAGGCTGAGG + Intergenic
1135427275 16:22349376-22349398 TCAGCTCCTCCACTTGGCTCTGG + Exonic
1137732644 16:50699849-50699871 GCATGTTCTCCACATGGCTGTGG - Exonic
1138955338 16:61964587-61964609 GGACCTGCTGTACTTGGCTGAGG + Intronic
1140112027 16:72012687-72012709 GCAGCTTCCCCATTTAGCTGAGG - Intronic
1140146921 16:72320095-72320117 GCTGCTTCTGCTCCAGGCTGTGG - Intergenic
1141616282 16:85211547-85211569 GCAGCTTCTCCGCAGGGCTGAGG + Intergenic
1142135661 16:88450940-88450962 GCAGCCTCCCCTCTTGGCTGCGG + Intergenic
1142605293 17:1078046-1078068 GCAGCTCCCGCAGCTGGCTGGGG - Intronic
1142701463 17:1664521-1664543 TGAGCTACTGCACCTGGCTGAGG - Intronic
1143039714 17:4024889-4024911 GGAGCTTCTCCAGTTGGCAGTGG - Intronic
1144499239 17:15770909-15770931 GCAGCTCTTGGAGTTGGCTGAGG + Intergenic
1144694116 17:17289892-17289914 GCAGATTCCGCACGTGGCTGTGG - Intergenic
1145036117 17:19541769-19541791 GCAGCCTCTGCACATTGCAGAGG + Intronic
1145235159 17:21202778-21202800 GCATCCTCTGCCCTCGGCTGTGG + Intronic
1146137335 17:30334484-30334506 ACAGCTTATGCACTGGGCTTGGG - Intergenic
1147188274 17:38724676-38724698 GCAGCGCCTGCAGATGGCTGGGG + Exonic
1147197553 17:38777743-38777765 GCAGCTTCTGCCCTTCATTGAGG + Exonic
1150706417 17:67491230-67491252 GCAGCTGGTGCACTTGACTCTGG + Intronic
1151454448 17:74217739-74217761 GGGGCTTCTGCACTGGGCAGGGG - Intronic
1151698952 17:75732325-75732347 GCACCTTGTACACCTGGCTGGGG + Intronic
1152191717 17:78892167-78892189 CCAGCTCCAGCGCTTGGCTGAGG - Exonic
1152572515 17:81127017-81127039 GCAGCTCCTGCACTGAGCCGAGG - Intronic
1153248908 18:3100752-3100774 GCAGGTTCTGCCCTTGGCGGGGG - Intronic
1154272040 18:12928861-12928883 GAAGCTCTTGCACATGGCTGCGG + Intronic
1154475251 18:14748560-14748582 CCAGCTTCTGGACTTGGCCCCGG - Exonic
1156045132 18:32869570-32869592 ACAGCTTTTGCACTCGCCTGAGG - Intergenic
1157479603 18:48044996-48045018 GCAGGAGCTGCAATTGGCTGTGG - Intronic
1160493076 18:79354288-79354310 TGAGCCACTGCACTTGGCTGGGG - Intronic
1160580884 18:79884172-79884194 GCAGCTTCTGTGCTGTGCTGGGG - Intronic
1160939175 19:1612141-1612163 CCAGCATCTGCACCTGGGTGTGG + Intronic
1161162847 19:2770201-2770223 GCTGCTTCTGCTCATGTCTGTGG + Intronic
1161575277 19:5051443-5051465 AAAGCTTCTGCTCTTGGCGGTGG - Intronic
1163329934 19:16629485-16629507 GCTGCTTCTGCACGTGGCTATGG + Intronic
1164415745 19:28045299-28045321 CCAGCTTATGCACCTGGCTCTGG + Intergenic
1165091350 19:33389807-33389829 GCAGCTGCGCCACTGGGCTGAGG - Intronic
1165444914 19:35851412-35851434 GCAGCTTCCGCTGGTGGCTGAGG + Intronic
1165829730 19:38724421-38724443 CCAGCTGCTGCACCTGGCAGAGG - Exonic
1168126532 19:54286409-54286431 TCAGGGTCTGCACTGGGCTGAGG + Intergenic
1168175361 19:54624454-54624476 TCAGGGTCTGCACTGGGCTGAGG - Intronic
925158070 2:1662334-1662356 GCAGCCTCTGCACAGGGCAGGGG + Intronic
926228167 2:10983195-10983217 GCACCCTCTGCACTTTGCAGCGG + Intergenic
926245182 2:11117949-11117971 GCAGCCTCTGCAATTTCCTGGGG - Intergenic
926356489 2:12045431-12045453 GAACCTTCAGCACTTGGCTCAGG - Intergenic
926741346 2:16114095-16114117 GCAGCTTCTCCACCTGTCTCTGG - Intergenic
926749369 2:16186234-16186256 GCAGCTGGAGCACCTGGCTGGGG + Intergenic
927708610 2:25311956-25311978 GCTGCTGCTGCTCTGGGCTGCGG - Intronic
928195517 2:29214033-29214055 GGACCTTCTGCACGTGGCTCGGG - Exonic
929805446 2:45140858-45140880 GCAATTCCTGCACTTGGGTGTGG + Intergenic
931897137 2:66744826-66744848 CCAGTGTCTGCTCTTGGCTGTGG - Intergenic
932365899 2:71153435-71153457 GCAGCTGCTGAACATGCCTGAGG + Intergenic
933863998 2:86499702-86499724 GCACCTTCTTCACATGGCAGAGG + Intergenic
935278876 2:101500694-101500716 GCAGAATTTGCACTTGGCTTTGG - Intergenic
935379106 2:102432659-102432681 GCACCTTCTGGACCTGGGTGGGG + Intronic
937227994 2:120380763-120380785 GCTGGGTCTGCACGTGGCTGGGG - Intergenic
937299713 2:120831786-120831808 TCAGTTTCTGCATTTGTCTGTGG + Intronic
937361202 2:121231398-121231420 GCACCTTCACCACTTGGCAGAGG + Intronic
937428481 2:121818671-121818693 GCAGCTCTGGCCCTTGGCTGGGG - Intergenic
939254190 2:139721443-139721465 GAAGCTTCAGGACTTGGCTATGG - Intergenic
939895701 2:147788652-147788674 GCAGTTTCTGCAATTAACTGAGG - Intergenic
940011488 2:149059832-149059854 GCAGCCTGTGCACTTGCCTGGGG + Intronic
941458651 2:165740195-165740217 GCAGCTTCTGCAGTTGAAGGTGG - Intergenic
942543173 2:177035728-177035750 GCTGCCTGTGCACTTGGCTCAGG + Intergenic
944069964 2:195657440-195657462 GCAGCTGCTGCAGTCGGCGGCGG + Intronic
944553191 2:200864297-200864319 GGAGCTTCTGCCCTCCGCTGAGG - Exonic
945777915 2:214130345-214130367 ACAGCTCCCTCACTTGGCTGTGG + Intronic
947091078 2:226512117-226512139 GCAGCTTTTGAAGATGGCTGGGG - Intergenic
948896710 2:240931051-240931073 GCAGCTTCGGGACAAGGCTGGGG + Exonic
948949860 2:241242465-241242487 GCAGCTCCTGCATCTGGCGGAGG - Exonic
1168934603 20:1653129-1653151 GCAGCTGCTGCTCTTGGGTGTGG - Intronic
1169977806 20:11350352-11350374 GGAGGTTCTGGCCTTGGCTGTGG + Intergenic
1170956553 20:20985315-20985337 GCAGGCTCTGCCTTTGGCTGGGG - Intergenic
1171145359 20:22776640-22776662 GGAGCATCTGAACTTTGCTGCGG - Intergenic
1171458114 20:25283202-25283224 GCAGCTTCTTCAGCTGGCTCAGG - Exonic
1171851210 20:30309474-30309496 GCAGCTACTGCAGTGGCCTGGGG - Intergenic
1171988583 20:31678104-31678126 GCATCTTTTGCACTGTGCTGAGG + Intronic
1173423823 20:42926170-42926192 GCAGGCTCTGCACCTGCCTGAGG + Intronic
1174396300 20:50248647-50248669 TCAGAGTCTGCACATGGCTGAGG - Intergenic
1174484854 20:50854811-50854833 GCAGCTTCAGGACTTGGCTTTGG - Intronic
1174824174 20:53754510-53754532 GCAGCTCCTGCCCTGGGCTGTGG - Intergenic
1177524241 21:22271489-22271511 TCAGCCACTGCACCTGGCTGGGG + Intergenic
1178182709 21:30181780-30181802 GTAACATCTGCACTTGGCTGTGG + Intergenic
1178494800 21:33077625-33077647 GTACCTTCTGCCCATGGCTGTGG - Intergenic
1179044038 21:37829426-37829448 GGTGCTTCTGCACTTGGGTTTGG + Intronic
1179512794 21:41884923-41884945 ACAGCGTCGGCACTTGCCTGGGG - Intergenic
1179900579 21:44391427-44391449 GCACCTTCTGCAGCTTGCTGTGG - Exonic
1180257672 21:46643841-46643863 GGTGCTTCTGCCCCTGGCTGAGG - Intronic
1180671841 22:17559693-17559715 GGAGCATCTGTAATTGGCTGTGG + Intergenic
1182244306 22:28943281-28943303 GCAGCTGCTGGACTTTGATGGGG + Intronic
1182317661 22:29458789-29458811 TGAGCTACTGCACCTGGCTGGGG - Intergenic
1182462545 22:30492616-30492638 CCAGCACCTGCTCTTGGCTGTGG - Intronic
1182766956 22:32764574-32764596 GCAGGTTCTGGTCTTGGCTGGGG + Intronic
1183579938 22:38718163-38718185 CCAGCTTCTTGACTGGGCTGAGG + Intronic
1184258768 22:43302553-43302575 ACAGCTACTGCCCTGGGCTGAGG - Intronic
1184597921 22:45525564-45525586 GCAGCTCCTCCAGCTGGCTGTGG - Exonic
950643598 3:14363976-14363998 TCAGAGTCTGCATTTGGCTGAGG - Intergenic
953355349 3:42251683-42251705 GCAGCATAGTCACTTGGCTGGGG + Intergenic
954316723 3:49805537-49805559 GCAGCTCCTGCTCCTGGCTTGGG - Intronic
957234511 3:77568341-77568363 GCTCTTTCTGCACTTGCCTGTGG - Exonic
960278928 3:115759142-115759164 CCATCTCCTTCACTTGGCTGAGG + Intergenic
960989437 3:123301249-123301271 ACGGCTTCTGCCCTGGGCTGGGG + Intronic
961627896 3:128276164-128276186 GCAGCCTCTGCCCTTGACAGTGG + Intronic
963606603 3:147417771-147417793 GGAACTTGTGCCCTTGGCTGTGG + Intronic
964350085 3:155794049-155794071 GCAGCTGCTGCAGTGAGCTGAGG - Intronic
964518160 3:157534875-157534897 GCAGCTCCTGCACCATGCTGGGG + Intergenic
968289683 3:197528897-197528919 GCAGCCTCTGCCCTGTGCTGTGG + Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
972892929 4:43582055-43582077 CCAGCTGCTGCCATTGGCTGTGG + Intergenic
973632688 4:52834190-52834212 GGAGCTTCTCCCCTTGTCTGTGG - Intergenic
973758830 4:54099606-54099628 ACAGCTTTTGGACTTGGCAGAGG - Intronic
975576908 4:75872238-75872260 GCAGCTTCTGCAGTTGAGTTGGG - Intronic
975650253 4:76586043-76586065 GCAGCTCCTGCAAGTGGCGGCGG + Intronic
978535550 4:109758244-109758266 TGAGCCACTGCACTTGGCTGGGG + Intronic
978643943 4:110906442-110906464 GGGGCTGCTGCTCTTGGCTGGGG + Intergenic
981286113 4:143020669-143020691 GCAGCTTCAGCTCTGGCCTGAGG + Intergenic
981294730 4:143118620-143118642 GCAGATTCTTCACTTGGCAAAGG - Intergenic
981577855 4:146223471-146223493 CCAGCTTCTGCCCTTGGCTTTGG + Intergenic
982327000 4:154138067-154138089 GGGGTTTCTGCAGTTGGCTGGGG + Intergenic
983587873 4:169375388-169375410 ACAGCTTCTGCTCTGGCCTGAGG - Intergenic
983664704 4:170167893-170167915 GCAGCTTGGCCGCTTGGCTGTGG + Intergenic
987109965 5:14676522-14676544 TCTGATTCAGCACTTGGCTGTGG + Intronic
987536799 5:19200132-19200154 GCTGCTGCTGTGCTTGGCTGGGG - Intergenic
988165477 5:27583613-27583635 GAATCTTCTGCAACTGGCTGTGG - Intergenic
990252925 5:53935284-53935306 GCAGCTACTGCTCCTGGATGAGG - Intronic
994525767 5:100903253-100903275 GCAGCTTCTGCAGCTGGGTTCGG + Exonic
995884628 5:116880109-116880131 GAATCTGCTGTACTTGGCTGAGG + Intergenic
996126556 5:119732115-119732137 GCAGCTTCAGCCCCTGCCTGTGG + Intergenic
996521964 5:124437209-124437231 GCAGCTTCTGGGGATGGCTGAGG + Intergenic
998262741 5:140643618-140643640 GCTGCTGTTGGACTTGGCTGGGG + Exonic
999232284 5:150068755-150068777 GCAGCTTCTCCACATGCCTTTGG + Intronic
999938674 5:156516405-156516427 ACAGCTGCTGCAGTTTGCTGGGG - Intronic
1001707406 5:173751371-173751393 GCAGGTGGTGCAGTTGGCTGTGG + Intergenic
1002597508 5:180334015-180334037 CCAGCTTCTGCACTTGACCTGGG + Intronic
1003990738 6:11483797-11483819 GCATCTACTTCACATGGCTGTGG + Intergenic
1004298704 6:14437572-14437594 GCAGATTGGGCACTTGGCAGTGG - Intergenic
1005623990 6:27646252-27646274 GCAGCTTCTGACCTGGGCTGAGG - Intergenic
1006275432 6:33001486-33001508 GCTGCTTCTGCACTAGGCTTGGG - Intergenic
1006320375 6:33316219-33316241 GCAGCTTCTGCAGTGGGCAGTGG - Exonic
1006495129 6:34417314-34417336 GCTGCTGCTGTACTTGGCTTTGG - Intronic
1006515050 6:34541143-34541165 GCCACTTCTGCACATTGCTGGGG + Exonic
1007223845 6:40299294-40299316 GTGGCTTCTGCAATTGGCTGAGG + Intergenic
1007337342 6:41163092-41163114 TCTGCTTCTGCCCTTGGCTGGGG - Exonic
1007473804 6:42106501-42106523 GCAGCTTTTCCATCTGGCTGGGG + Exonic
1007941079 6:45782229-45782251 GCAGCTCCTCCACAAGGCTGAGG - Intergenic
1008535586 6:52504264-52504286 GCAGTAGCAGCACTTGGCTGGGG + Intronic
1009840885 6:69073258-69073280 GCAGCTTCTGCCCTTTGATGAGG - Intronic
1010996163 6:82535630-82535652 GCAGCTTCCACACCTGGATGGGG + Intergenic
1015184158 6:130394454-130394476 GCTGCTTCTGCTTTTGGCAGAGG + Intronic
1017595955 6:156028687-156028709 AGATCTTCTTCACTTGGCTGTGG - Intergenic
1017622056 6:156309200-156309222 TCAGGCTCTGCACATGGCTGAGG + Intergenic
1018029509 6:159830937-159830959 GCTGCTGCTCCACTGGGCTGAGG - Intergenic
1019073706 6:169370205-169370227 GCAGCAGCAGAACTTGGCTGGGG + Intergenic
1019722257 7:2580015-2580037 TCAGCCACTGCACCTGGCTGAGG + Intronic
1022520706 7:31005227-31005249 TCAGCCCCTGCACCTGGCTGAGG + Intergenic
1023983648 7:45083151-45083173 CCAGCTTCTGCAGCTGGCTGTGG + Exonic
1024949088 7:54839708-54839730 GCTGCATCTGCACTTGGCTTGGG + Intergenic
1026544730 7:71312035-71312057 GCAGTTACTGCCCCTGGCTGTGG + Intronic
1027201662 7:76067843-76067865 GCAGCTTCTGCTTTTGCTTGTGG - Intergenic
1028471015 7:91206354-91206376 GCAGCTTCTAAACTTAGCTAAGG + Intronic
1029316597 7:99721097-99721119 ACAGCTGCTGCAGTTGGCTGAGG + Intronic
1035034743 7:155887347-155887369 GGAGCTTCTGCACTTGGCTGTGG + Intergenic
1035112810 7:156497455-156497477 GCCGCGTCTGCACTGGGCTGAGG - Intergenic
1035755234 8:2026052-2026074 GCAGCTTCTGCCGGAGGCTGTGG + Intergenic
1035970553 8:4243171-4243193 GAAGCCTCTGCTCTGGGCTGAGG + Intronic
1036710299 8:11074234-11074256 GCAGCTTCTGCAGTTCCCTGTGG - Intronic
1036930637 8:12952113-12952135 GCAGCTTTTGCCCCTGGCTGCGG + Intronic
1037324678 8:17676526-17676548 GCAGCTTCTGCCTTTGGCACAGG + Intronic
1037990546 8:23318880-23318902 GCAGCTTCTGCTCAGGGCTCAGG + Intronic
1038459396 8:27703268-27703290 GCAGCACCTGCACCTGGCAGAGG + Intergenic
1039030118 8:33299654-33299676 GCAGCTGCTGCAAGGGGCTGGGG - Intergenic
1040452414 8:47561420-47561442 GCAGCTTCTTCAAGTGGTTGAGG - Intronic
1041413146 8:57578558-57578580 GAAGCTTCTGTACTTGACTCAGG - Intergenic
1043320755 8:78982882-78982904 GCTGCCTCTACACTTGGCAGTGG + Intergenic
1043951917 8:86318896-86318918 ATAGCTTCTCCACTTGGCTTGGG - Intronic
1045189513 8:99869004-99869026 GCAGTACCTGCACTTGGATGGGG + Intronic
1045720633 8:105106369-105106391 GGAGCTTCCTCATTTGGCTGTGG - Intronic
1046721798 8:117628431-117628453 GCATGTTCTGCACATGGATGTGG - Intergenic
1048292612 8:133192088-133192110 GCAGGTCCTGCCCTGGGCTGTGG - Intronic
1049219636 8:141423014-141423036 GCAGCGTCTGCAGTTGTGTGCGG + Intronic
1049230064 8:141477338-141477360 GCAGCCTCTCCACTTGGGTTTGG - Intergenic
1049718602 8:144105198-144105220 GCAGCCTCTTACCTTGGCTGAGG + Intronic
1050644984 9:7709889-7709911 GCATCTCTTGCACTTGGGTGTGG - Intergenic
1051371707 9:16364684-16364706 GCAGCTTCTCCACATGCCTGAGG - Intergenic
1051954036 9:22668055-22668077 GCATCTTTTACAGTTGGCTGAGG - Intergenic
1051961881 9:22775802-22775824 GCAGCATCTGCATATGGCTATGG - Intergenic
1053152999 9:35754662-35754684 GCAGCTCCTGGGTTTGGCTGGGG - Exonic
1058744559 9:107977026-107977048 ATCACTTCTGCACTTGGCTGAGG - Intergenic
1059301420 9:113316769-113316791 GCAGTTCCAGCCCTTGGCTGTGG + Exonic
1060147822 9:121267851-121267873 GCAGCTCCTGAGCTGGGCTGGGG - Intronic
1061119371 9:128633854-128633876 GCAGACTCAGCTCTTGGCTGCGG - Exonic
1061777149 9:132973182-132973204 GCAGCTTCTGGCCTTGGCCCAGG - Intronic
1061972991 9:134054784-134054806 GCAGCATTTGCCCATGGCTGTGG - Intronic
1062282984 9:135760197-135760219 GCTGCTGCTGCACCTGGCTGTGG - Intronic
1186064238 X:5744251-5744273 GAAGCTTCTGAATTTGGCAGCGG + Intergenic
1186371280 X:8949792-8949814 GAATCTTCAGCACTGGGCTGGGG - Intergenic
1186410893 X:9343330-9343352 GGGGCTTCTTCACTTCGCTGTGG + Intergenic
1189255701 X:39637293-39637315 GCAGCTTCCTTGCTTGGCTGTGG - Intergenic
1189712337 X:43826454-43826476 GCATCTCCAGCACTTGGCTCAGG - Intronic
1191258623 X:58290793-58290815 GCAGCTTCTGCACCAGGCCAGGG + Intergenic
1191258921 X:58292097-58292119 ACAGCCTCTGCACTGGGCTAGGG + Intergenic
1192167060 X:68832940-68832962 GCAGCAGCTGGACTTGGCTGAGG - Intronic
1193504033 X:82317937-82317959 GCAGCTTCTGCAAGTGTCTTTGG - Intergenic
1194809474 X:98373164-98373186 ACAGCCTCTGCAGTTGGCTTTGG + Intergenic
1197892218 X:131278936-131278958 CAAGCTTCTGCACTTTTCTGAGG - Intronic
1198302091 X:135343347-135343369 GCAGCTTCTGCACCCTGCTGTGG + Exonic
1200278050 X:154752420-154752442 GCAGCTTGAGCACTTAGCAGTGG + Intergenic
1201525993 Y:14935208-14935230 GCTGCTTCTGCCCTTGGCCTAGG - Intergenic
1201532207 Y:15004407-15004429 GAAGCTTCTGAATTTGGCAGTGG - Intergenic