ID: 1067733137

View in Genome Browser
Species Human (GRCh38)
Location 10:48828262-48828284
Sequence TCCAGCAAAATTAAAATGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067733134_1067733137 10 Left 1067733134 10:48828229-48828251 CCACTTACAACTGGCTACATCAT No data
Right 1067733137 10:48828262-48828284 TCCAGCAAAATTAAAATGCTAGG No data
1067733132_1067733137 12 Left 1067733132 10:48828227-48828249 CCCCACTTACAACTGGCTACATC No data
Right 1067733137 10:48828262-48828284 TCCAGCAAAATTAAAATGCTAGG No data
1067733130_1067733137 21 Left 1067733130 10:48828218-48828240 CCACTGTGTCCCCACTTACAACT No data
Right 1067733137 10:48828262-48828284 TCCAGCAAAATTAAAATGCTAGG No data
1067733133_1067733137 11 Left 1067733133 10:48828228-48828250 CCCACTTACAACTGGCTACATCA No data
Right 1067733137 10:48828262-48828284 TCCAGCAAAATTAAAATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067733137 Original CRISPR TCCAGCAAAATTAAAATGCT AGG Intronic