ID: 1067733341

View in Genome Browser
Species Human (GRCh38)
Location 10:48829944-48829966
Sequence TGGTTTTGATTACAACACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067733338_1067733341 17 Left 1067733338 10:48829904-48829926 CCATGCTCAAAAATCTCGTGACT No data
Right 1067733341 10:48829944-48829966 TGGTTTTGATTACAACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067733341 Original CRISPR TGGTTTTGATTACAACACAG AGG Intronic