ID: 1067735995

View in Genome Browser
Species Human (GRCh38)
Location 10:48851294-48851316
Sequence AAGCATCCACATATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 325}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067735995_1067735999 9 Left 1067735995 10:48851294-48851316 CCCTCCTCCATATGTGGATGCTT 0: 1
1: 0
2: 4
3: 25
4: 325
Right 1067735999 10:48851326-48851348 CATTTTGTGCTGCTATCAACAGG No data
1067735995_1067736001 14 Left 1067735995 10:48851294-48851316 CCCTCCTCCATATGTGGATGCTT 0: 1
1: 0
2: 4
3: 25
4: 325
Right 1067736001 10:48851331-48851353 TGTGCTGCTATCAACAGGGATGG No data
1067735995_1067736000 10 Left 1067735995 10:48851294-48851316 CCCTCCTCCATATGTGGATGCTT 0: 1
1: 0
2: 4
3: 25
4: 325
Right 1067736000 10:48851327-48851349 ATTTTGTGCTGCTATCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067735995 Original CRISPR AAGCATCCACATATGGAGGA GGG (reversed) Intronic
901528029 1:9836228-9836250 GAGCCTCCACACATGGTGGAGGG + Intergenic
902064895 1:13676884-13676906 AAGCTTCCACTCATGGTGGAAGG + Intergenic
902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG + Intergenic
904461287 1:30681645-30681667 AGGGATTCAAATATGGAGGAGGG + Intergenic
905485734 1:38294892-38294914 CTGTATCCTCATATGGAGGAAGG + Intergenic
906371448 1:45257379-45257401 AAGCTTCCAATTATGGTGGATGG - Intronic
906446039 1:45898925-45898947 AAGAATGCCCATATGGAGCATGG - Intronic
906698116 1:47838379-47838401 GAGCATCCATCTCTGGAGGAGGG + Intronic
906948367 1:50315015-50315037 TATCATCCACATTTGGAAGATGG + Intergenic
907742257 1:57178258-57178280 AAGCTTGCAATTATGGAGGATGG - Intronic
911087316 1:93989761-93989783 ATGCAGCCACTTAAGGAGGACGG + Intergenic
911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG + Intergenic
912195375 1:107391636-107391658 AAGCTTCCACTCATGGTGGAAGG + Intronic
912547392 1:110460802-110460824 AAGGATACACAAATGAAGGAAGG - Intergenic
913076684 1:115346035-115346057 AAGCTTCCACTCATGGTGGAAGG - Intergenic
913345484 1:117805430-117805452 AAGCTTCCACTCATGGAAGAAGG + Intergenic
913478114 1:119258609-119258631 AAGCTTCCACTTAAGGTGGAAGG - Intergenic
915222287 1:154384736-154384758 AAGCATCGTCATTTGGAGGTTGG - Intergenic
915661275 1:157407690-157407712 AAGCTTCCACTTATGGTGGAAGG + Intergenic
916758225 1:167793320-167793342 AAGCTTCCAAATATGGCGGAAGG - Intergenic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
918412737 1:184277135-184277157 ATGCTTCCACTCATGGAGGAAGG - Intergenic
919869983 1:201812893-201812915 AAGGAGGCACATATGTAGGAAGG + Intronic
921960400 1:221027865-221027887 AAGCTTCCACTCATGGTGGAAGG - Intergenic
922325760 1:224526823-224526845 AAGCTTCCAATTATGGTGGAAGG + Intronic
923767800 1:236908923-236908945 AAGCTTCCAGTCATGGAGGAAGG + Intergenic
924038159 1:239956742-239956764 TAACATCCACATAGAGAGGATGG + Intergenic
1063842089 10:10083422-10083444 AAGCTTCCAAACATGGCGGAAGG - Intergenic
1064161967 10:12954537-12954559 AAGCTTCCACTCATGGTGGAAGG + Intronic
1064864017 10:19858960-19858982 AAGCTTCCACTCATGGTGGAAGG + Intronic
1065655148 10:27940987-27941009 AAGCTCCCAAATCTGGAGGAAGG - Intronic
1065857642 10:29843177-29843199 TAGCATCCACATCTGTTGGATGG + Intergenic
1065863074 10:29887705-29887727 AAGCTTCCACTCATGGTGGAAGG - Intergenic
1065996150 10:31061206-31061228 AAGCTTCCAAACATGGTGGAAGG - Intergenic
1066383419 10:34921092-34921114 AAGCTTCCACACATTGGGGAAGG + Intergenic
1066473934 10:35726059-35726081 AAGCTTCCACTCATGGTGGAAGG - Intergenic
1067053472 10:43038360-43038382 AAGCATCCACACTCTGAGGAGGG + Intergenic
1067735995 10:48851294-48851316 AAGCATCCACATATGGAGGAGGG - Intronic
1067994398 10:51255065-51255087 AAGCATTCATATATGCTGGAAGG - Intronic
1068698691 10:59997196-59997218 AATCATGCACATGAGGAGGATGG - Intergenic
1068757842 10:60674371-60674393 AAGCTTCCACTCATGGTGGAAGG + Intronic
1069176554 10:65296549-65296571 TAGCATCTTCATATGGAGAATGG - Intergenic
1069860533 10:71468467-71468489 AAGCATCCACACAGGCTGGAAGG - Intronic
1070378040 10:75853411-75853433 AAGCATCCACCTAAAGAAGAGGG + Intronic
1071119600 10:82262023-82262045 AAGCTTCCAATTATGGTGGAAGG - Intronic
1072231992 10:93421708-93421730 AAGCTTCCACTCATGGGGGAAGG - Intronic
1072506576 10:96073898-96073920 AACCATCCACATCTGCAAGAAGG + Intergenic
1072577373 10:96712647-96712669 AACCAGCCACATAGGAAGGAAGG - Intronic
1074820939 10:117177925-117177947 AAGCCTCCAATTATGGTGGAAGG + Intergenic
1076429505 10:130391692-130391714 AAGCGTCCAGAAATGGAGGAGGG + Intergenic
1076925734 10:133484417-133484439 AAGCTTCCACTCATGGAAGAAGG + Intergenic
1078472260 11:11600050-11600072 AAGCACAAAAATATGGAGGAGGG - Intronic
1079890716 11:26049459-26049481 AAGCATGAACATCTGGAGGCAGG - Intergenic
1081139547 11:39481765-39481787 AATCTTCCACTCATGGAGGAAGG - Intergenic
1081529290 11:43947108-43947130 AAGCTTCCACTCATGGTGGAAGG + Intergenic
1081757346 11:45554161-45554183 AAGCTTGACCATATGGAGGAGGG + Intergenic
1082822996 11:57557333-57557355 AAGCTTCCACTCATGGTGGAAGG - Intronic
1083255509 11:61493080-61493102 AAGCTTCCACTCATGGTGGAAGG - Intergenic
1084358664 11:68655681-68655703 CAGCATCCAGCTATGGAGGTAGG - Intergenic
1084421316 11:69062091-69062113 AAGCATCCACTCATGGCAGAAGG + Intronic
1084682425 11:70674156-70674178 AAGCTTCCACTCATGGCGGAAGG - Intronic
1085321047 11:75574242-75574264 CATCATGCACATATCGAGGAAGG + Intergenic
1085556639 11:77428715-77428737 GAGCATCCACATTTGGGGCAGGG + Intronic
1087849612 11:103012930-103012952 AAGCATCCACATAGCAGGGAAGG + Intergenic
1088698765 11:112392850-112392872 AAGTCTTCACATTTGGAGGAGGG + Intergenic
1088717620 11:112562609-112562631 AAGCTTCCAAGTATGGTGGAAGG - Intergenic
1089282139 11:117381883-117381905 AAGCATCCTCATGAGGATGAGGG + Intronic
1091028940 11:132166476-132166498 AAGCCCCAACACATGGAGGAGGG + Intronic
1092071348 12:5633911-5633933 AGGCATGCATATAGGGAGGAGGG - Intronic
1094090664 12:26645441-26645463 AAGGAACCACATATGGAAGATGG + Intronic
1094260780 12:28496286-28496308 AAGTATCCAAATTTGGGGGATGG - Intronic
1096369353 12:51056039-51056061 AAGATTCCACATTTGTAGGAAGG - Intronic
1096879858 12:54658708-54658730 CAGCCTCCACATATTGAGAACGG - Intergenic
1097420740 12:59375799-59375821 AAGCATCGACAATAGGAGGAGGG + Intergenic
1098184854 12:67885421-67885443 AAGCGTCCACATAGGGAAGGAGG - Intergenic
1099184442 12:79502665-79502687 AAGCTTCCAATCATGGAGGACGG + Intergenic
1099218993 12:79889872-79889894 ACGTATCCTCATATGGTGGAAGG + Intronic
1102448430 12:113022192-113022214 AAGCTTCCAATTATGGTGGAAGG + Intergenic
1104267651 12:127251193-127251215 TAGCATCCACATATGGATGTTGG - Intergenic
1104487303 12:129162726-129162748 AAGCTTCCAAACATGGTGGAAGG - Intronic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1105238194 13:18582088-18582110 AAGCTTCCAAACATGGCGGAAGG + Intergenic
1106366427 13:29085144-29085166 AAGCTTCCACTCATGGTGGAAGG - Intronic
1106401516 13:29435791-29435813 AAACAAGCACTTATGGAGGAAGG + Intronic
1106653846 13:31721100-31721122 AAGCTTCCACTCATGGTGGAAGG - Intergenic
1106856942 13:33864058-33864080 AAGCTTCCACTCATGGTGGAAGG + Intronic
1107125165 13:36838613-36838635 AAGCCTCCAGCTCTGGAGGATGG - Intergenic
1108174429 13:47777675-47777697 AAGCTTCCAATTATGGTGGAAGG - Intergenic
1109877308 13:68422437-68422459 AAGCATCCAAATATGAAGAGAGG - Intergenic
1109935518 13:69278305-69278327 CAGCATCCTCATATGGTGTAAGG - Intergenic
1110502934 13:76249946-76249968 AAGCTTCCAATTATGGTGGAAGG - Intergenic
1117436218 14:55717308-55717330 AAGCGGCCACATATGTAGCAGGG + Intergenic
1118666054 14:68071229-68071251 AGGCATCCACATAGGAAGAAAGG - Intronic
1119448019 14:74682839-74682861 AAGCTTCCACTCATGGTGGAAGG - Intronic
1119606664 14:76024215-76024237 AAGCATCCACATCTCAGGGATGG + Intronic
1120819591 14:88899854-88899876 AAGCTTCCACTCATGGTGGAAGG - Intergenic
1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG + Intronic
1121734288 14:96206948-96206970 ATGCATCCTCATATGGTGGAAGG + Intronic
1124122320 15:26898545-26898567 AAGCAGCAACATCTGTAGGATGG + Intronic
1124393921 15:29284013-29284035 AAGGATCAAGATATGGAGGGTGG + Intronic
1125128493 15:36253102-36253124 CAGGCTCCAGATATGGAGGAAGG + Intergenic
1126188911 15:45858882-45858904 AAGCTTCCAATTATGGAAGAAGG - Intergenic
1126264027 15:46731318-46731340 ATGCATCCCCATATGGCAGAAGG + Intergenic
1126553383 15:49958347-49958369 AAGCATCCAAGTATGAAGTAGGG + Intronic
1126654731 15:50965048-50965070 AAGCTTTTACTTATGGAGGAAGG - Intronic
1126815201 15:52447340-52447362 AAGCTTCCACTCATGGTGGAAGG - Intronic
1127834461 15:62779439-62779461 TAGCACCCACAAAAGGAGGAAGG + Intronic
1128892964 15:71347345-71347367 TGGCATCCACATATGAGGGAGGG - Intronic
1129697439 15:77748583-77748605 AAGAAGCAACACATGGAGGAAGG + Intronic
1131291647 15:91111799-91111821 AAGCTTCCAATTATGGAAGAAGG + Intronic
1131333719 15:91526673-91526695 AAGCTTCCACTCATGGTGGAAGG - Intergenic
1132181338 15:99755000-99755022 AAGCTTCCAAACATGGCGGAAGG + Intergenic
1132512207 16:349150-349172 AAGCACCCATAGATGGAGGATGG + Intronic
1132993194 16:2807990-2808012 AAGCTTCCACTCATGGCGGAAGG + Intergenic
1133406334 16:5527419-5527441 TAGAAGCCACATATTGAGGATGG + Intergenic
1136688313 16:32009146-32009168 AACCATCCACACAGGGAGGCGGG - Intergenic
1136788914 16:32952701-32952723 AACCATCCACACAGGGAGGCAGG - Intergenic
1136880898 16:33901233-33901255 AACCATCCACACAGGGAGGCAGG + Intergenic
1137689416 16:50411240-50411262 AAGATTCCACAGATGGAGGGTGG - Intergenic
1137727874 16:50669322-50669344 AAGCTTCCACTTATGGTGGAAGG + Intronic
1138073204 16:54014451-54014473 AAGCTTCCACTCATGGTGGAAGG - Intronic
1139015570 16:62684866-62684888 AGGCACCCACATCTGGACGAGGG - Intergenic
1141284093 16:82655028-82655050 AAGCTTCCAGAACTGGAGGATGG + Intronic
1203091111 16_KI270728v1_random:1214190-1214212 AACCATCCACACAGGGAGGCGGG - Intergenic
1146633780 17:34489294-34489316 AAGCAGCCAAGTCTGGAGGAAGG + Intergenic
1146644844 17:34570543-34570565 AAGCTTCCAATCATGGAGGAAGG + Intergenic
1148166092 17:45484997-45485019 AAGCAGGCATGTATGGAGGATGG + Intronic
1149021130 17:51965893-51965915 AAGCATCCAAATAGGAAGAAAGG + Intronic
1149192542 17:54081673-54081695 AAGCGTCCAAACATGGAGTAAGG + Intergenic
1150151409 17:62811800-62811822 TTGCATCCTCATATGGTGGAAGG + Intergenic
1150397315 17:64831721-64831743 AAGCAGGCATGTATGGAGGATGG + Intergenic
1151248749 17:72817216-72817238 AAGCTTCCACTCATGGTGGAAGG + Intronic
1152061714 17:78081121-78081143 ATGCATCCTCATGTGGTGGAAGG + Intronic
1152196137 17:78919474-78919496 AAGAAGCCGCATCTGGAGGACGG - Intronic
1153744031 18:8158740-8158762 AAGCTTCCAATCATGGAGGAAGG + Intronic
1154183268 18:12156154-12156176 AAGCTTCCAATTATGGTGGAAGG - Intergenic
1155430607 18:25752183-25752205 AAGCATCCAATTATGGTGGAAGG - Intergenic
1156827642 18:41451008-41451030 AAGCTTCCACTCATGGAAGAAGG - Intergenic
1158212574 18:55067693-55067715 TAGCATTCAGAGATGGAGGATGG - Intergenic
1159259983 18:66001959-66001981 AACCATCTGCATATGGGGGAGGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1160039330 18:75331803-75331825 ACCCATCCACATCTCGAGGAAGG + Intergenic
1160291916 18:77602804-77602826 AAGCATCCAATCATGGTGGAAGG + Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1164851330 19:31486713-31486735 AAGCATCCAATTGTGGTGGAAGG + Intergenic
1165178333 19:33946471-33946493 AAGCTTCCACCCATGGTGGAAGG - Intergenic
1167714435 19:51132220-51132242 AAGCTTCCACTCATGGTGGAAGG - Intronic
1168363618 19:55765114-55765136 ACTCATCCACATATAGAAGAAGG - Intergenic
925389151 2:3483698-3483720 GAGCACCCAGAGATGGAGGAAGG + Intronic
925900564 2:8506336-8506358 AAGCTTCCAATTGTGGAGGAAGG - Intergenic
926924774 2:17976440-17976462 AAGCTTCCACTCATGGGGGAAGG + Intronic
927314293 2:21664254-21664276 AAGCTTCCACTTATGACGGAAGG + Intergenic
931711902 2:64995158-64995180 AAGCATCAACCTAGGGAGGTGGG + Intronic
932359290 2:71091324-71091346 CTGCATCCTCATATGGTGGAAGG - Intergenic
934486149 2:94713210-94713232 ATGCATCCTCACATGGTGGAAGG - Intergenic
934918054 2:98316870-98316892 AAGCTTCCAATTATGGTGGAAGG - Intergenic
935400853 2:102658505-102658527 AAGCATCCCCAGATAGAGAATGG - Intronic
935491574 2:103727219-103727241 AAGCATCCAAATATGAAGAGAGG - Intergenic
935880395 2:107559169-107559191 AAGCTTCTACTTATGGTGGAAGG - Intergenic
936292099 2:111234171-111234193 AAGCTTCCACTTATGGCAGAAGG + Intergenic
936763372 2:115813796-115813818 AAACATTCACATAAAGAGGAAGG + Intronic
937498233 2:122448996-122449018 AAGCTTCCAATCATGGAGGAAGG + Intergenic
938178882 2:129162081-129162103 CAGCATCCTCATCTGGAGAATGG - Intergenic
939224952 2:139353430-139353452 AAGCATTCAGTTATTGAGGAAGG + Intergenic
939276949 2:140011279-140011301 AAGCATCAACACCTGCAGGATGG - Intergenic
940081860 2:149812084-149812106 AAGCTTCCAATCATGGAGGAGGG - Intergenic
940127363 2:150341592-150341614 AAGCTTCCAATTATGGTGGAAGG - Intergenic
941462615 2:165789269-165789291 AGGTATCCTCACATGGAGGAAGG + Intronic
941641030 2:167988616-167988638 AAGCCTTCACCTATGGAAGAAGG - Intronic
941998974 2:171627456-171627478 AGGCATCCACGTCTGGATGAGGG - Intergenic
942525953 2:176853092-176853114 AAGCAACCACTTAAGGAGGCCGG - Intergenic
942871179 2:180736159-180736181 AAGCTTCCACTTATGGTGGAAGG - Intergenic
943441517 2:187932925-187932947 AAGAATCTGGATATGGAGGATGG + Intergenic
946380951 2:219348606-219348628 AAGCATCCACACAGGCAGAAAGG + Intergenic
947385170 2:229584279-229584301 AACCATCCTCACCTGGAGGATGG - Intronic
947542428 2:230988193-230988215 AGGAAGCCACATATTGAGGATGG + Intergenic
948799716 2:240426859-240426881 AAGCTTCCACTCATGGTGGAAGG + Intergenic
1168875955 20:1172319-1172341 AAGCATCCTCATATGTAAAATGG + Intronic
1168960159 20:1863636-1863658 AATCAGCCACATAGGGAGTAGGG + Intergenic
1169612973 20:7403982-7404004 AAGTTTCCATATATGTAGGATGG + Intergenic
1169830031 20:9814988-9815010 CAGCTTCCACTTATGGTGGAAGG + Intronic
1172681343 20:36718198-36718220 AAGCATTCACATACTGGGGAGGG + Intronic
1173164774 20:40679940-40679962 AGGCTTACACATATGGAGGCAGG - Intergenic
1174530748 20:51211713-51211735 AAGCTGACACATATTGAGGAAGG + Intergenic
1176688338 21:9874915-9874937 AAACATACACTTATGGTGGAAGG + Intergenic
1176782180 21:13210365-13210387 AAGCTTCCAAACATGGCGGAAGG + Intergenic
1177786286 21:25675096-25675118 AAGCTTCCAATCATGGAGGAAGG + Intronic
1178310338 21:31524997-31525019 AAGCTTCCACTCATGGTGGAAGG + Intronic
1178387378 21:32163937-32163959 AAGCTTCCACTCATGGTGGAAGG + Intergenic
1178396730 21:32249690-32249712 AAGCTTCCACACATAGGGGAAGG + Intergenic
1179552014 21:42149555-42149577 ATGCACCCAAACATGGAGGAGGG + Intergenic
1180032602 21:45222658-45222680 AAGCATCTATATATGGAGGAGGG + Exonic
1180093837 21:45545430-45545452 AAGCTTCCACACATGGTGGAAGG - Intergenic
1180651079 22:17377693-17377715 AAATATGCAAATATGGAGGAAGG - Intronic
1181016487 22:20072217-20072239 AAGCATCTTCAGATGGAGTAGGG + Intergenic
1181893376 22:26084512-26084534 GAACAGCCACATAGGGAGGAGGG + Intergenic
1182720698 22:32396542-32396564 ATGCATTCACATATTGAGAAAGG - Intronic
1183616497 22:38948866-38948888 CAGCATCCACATCTGGAAGCTGG + Intergenic
1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG + Intronic
1184317104 22:43702985-43703007 AAGGACCCACATAGGCAGGAAGG + Intronic
949092349 3:43296-43318 ATTCATACACATATGGAAGATGG - Intergenic
951241393 3:20289552-20289574 AAGCTTCCAATCATGGAGGAAGG + Intergenic
952039901 3:29249353-29249375 AAGCTTCCAATTATGGAGCACGG - Intergenic
952124794 3:30287798-30287820 CTGCATCCACACATGGTGGAAGG - Intergenic
952686241 3:36151816-36151838 CTGCATCCTCATATGGTGGAAGG + Intergenic
952875058 3:37937743-37937765 GAGCAGTCAGATATGGAGGATGG + Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955631927 3:60983663-60983685 AAGCATACAGATCTGGAGGATGG + Intronic
956704919 3:71991478-71991500 AAGCTTCCACTCATGGTGGAAGG + Intergenic
957243054 3:77683912-77683934 AACGATCAACAGATGGAGGAAGG + Intergenic
957462351 3:80537865-80537887 AAACTTCCACATTTGGGGGAAGG + Intergenic
957514125 3:81229543-81229565 AAGCATCCTGATACTGAGGAGGG + Intergenic
960008984 3:112812676-112812698 AAGCTCCCACATGTTGAGGAGGG - Intronic
961382520 3:126505099-126505121 AAGCTTCCACTCATGGTGGAAGG - Intronic
961438168 3:126933519-126933541 AAGCTTACAATTATGGAGGAAGG + Intronic
961938699 3:130613979-130614001 AGGCATCCAAATATGAAGAAAGG - Intronic
962770481 3:138606729-138606751 GAGCATCCACACATGGCAGAAGG + Intergenic
963766809 3:149345348-149345370 AAATATCTACTTATGGAGGAGGG - Intergenic
964608546 3:158585361-158585383 ATGCTTCCACTTATGGAGGAAGG - Intronic
965751060 3:171975461-171975483 GAGCAGCCAGAGATGGAGGAGGG + Intergenic
966040076 3:175472976-175472998 AAGTATCCAGAAATAGAGGAGGG + Intronic
967237428 3:187399490-187399512 AAGCATCCACTTAAGGGGGAGGG + Intergenic
969435536 4:7187072-7187094 GTGTATCCACATGTGGAGGAAGG - Intergenic
970105156 4:12574384-12574406 AAGCTTTCACTTATGGTGGAAGG + Intergenic
970417554 4:15874324-15874346 AAGCTTCCAAACATGGCGGAAGG - Intergenic
971169610 4:24219654-24219676 AAGCGTCCATGTTTGGAGGAGGG - Intergenic
972391464 4:38617540-38617562 AAGCTTCCACTCATGGAAGAAGG - Intergenic
972978584 4:44667896-44667918 AATAAACCAAATATGGAGGAAGG + Intronic
973833388 4:54784635-54784657 AAGCATACACATAGTTAGGAAGG - Intergenic
974480249 4:62433545-62433567 AAGGATGCACAACTGGAGGATGG + Intergenic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
975447367 4:74481502-74481524 AAGCTTCCACTCATGGTGGAAGG + Intergenic
979986619 4:127324070-127324092 AAGCTTCCACTCATGGAGGAAGG - Intergenic
980269176 4:130562303-130562325 AAGCATCCACTCATGGCAGAAGG - Intergenic
980351713 4:131692715-131692737 AAACATACACTTATGGTGGAAGG + Intergenic
980770404 4:137364605-137364627 ATGCATCCTCATATGGCAGAAGG - Intergenic
981047612 4:140279889-140279911 GAGAAGCCACATATTGAGGATGG - Intronic
981240002 4:142465892-142465914 AAGCTTCCAATTATGGTGGAAGG - Intronic
981689137 4:147487016-147487038 AAGCTTCCAAATATGGCAGAGGG + Intronic
982162756 4:152586459-152586481 AAGCTTCCACTCATGGTGGAAGG - Intergenic
983813138 4:172089326-172089348 AAGCATCTTCAGTTGGAGGAGGG + Intronic
984609059 4:181817709-181817731 TTGCATCCTCATATGGAAGAAGG - Intergenic
985181424 4:187268296-187268318 AAGCTTCCAATCATGGAGGAAGG - Intergenic
985235699 4:187871525-187871547 AAGCTTCCGCTTATGGTGGAAGG - Intergenic
986147483 5:5092323-5092345 AAGCATCATAGTATGGAGGAGGG + Intergenic
988089339 5:26516078-26516100 AAACATACACAAATGGTGGAAGG - Intergenic
990214602 5:53515926-53515948 TAGCATCCTCACATGGTGGAAGG - Intergenic
990995703 5:61730327-61730349 AAGCTTCCACTCATGGTGGAAGG + Intronic
991102238 5:62805389-62805411 AAGCTTCCACTCATGGTGGAAGG - Intergenic
991317621 5:65327188-65327210 AAGCTTCCACTTGTGGTGGAAGG - Intronic
992041454 5:72837323-72837345 CAGCATCCTCACATGGAGGAAGG + Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992139234 5:73779642-73779664 AAGCACCCAAGGATGGAGGAGGG - Intronic
992144764 5:73835081-73835103 CAGCATCCACGGAAGGAGGAGGG + Intronic
993003315 5:82404717-82404739 AAGCTTCCACTCATGGTGGAAGG + Intergenic
995547436 5:113247128-113247150 TAGTTTACACATATGGAGGAAGG + Intronic
997828180 5:137126256-137126278 AAGCATCCACTCATGGTGGAAGG - Intronic
998363600 5:141613150-141613172 AAACATTCTCTTATGGAGGATGG - Intronic
998693110 5:144609852-144609874 AAGCTTCCAATTATGGTGGAAGG + Intergenic
998700775 5:144696995-144697017 GTGCATCCTCATATGGTGGAAGG - Intergenic
999900462 5:156081113-156081135 AAGCATACAATTATGGTGGAAGG + Intronic
1000004938 5:157174946-157174968 ACCCATCCACAGATGGGGGAGGG - Intronic
1000750112 5:165084793-165084815 AAGTATCCTCATATGGGGGAAGG + Intergenic
1001767246 5:174260137-174260159 AGGCATCTAAATATGAAGGAGGG + Intergenic
1005489658 6:26335781-26335803 AAGCTTCCACTCATGGTGGAAGG + Intergenic
1006603488 6:35241130-35241152 ATTCATCCACATCTGGGGGAAGG - Exonic
1007116449 6:39346412-39346434 ACGCATCCTCACATGGTGGAAGG - Intronic
1008423462 6:51329817-51329839 AAGCTTCCACTCATGGTGGAAGG - Intergenic
1008432034 6:51429651-51429673 AAGAGTCCACAGGTGGAGGAGGG - Intergenic
1008684737 6:53912494-53912516 AAGCACCCAGATATGTAGAAAGG - Intronic
1008695343 6:54029431-54029453 AGGCATCCTCACATGGTGGAAGG - Intronic
1009460982 6:63912816-63912838 AAGCTTCCAAACATGGTGGAAGG - Intronic
1009530134 6:64803037-64803059 AGGCACCCACATCTGGACGAGGG + Intronic
1010377221 6:75185150-75185172 AAGCATCCAAATATGAAGAAAGG + Intronic
1010885989 6:81241287-81241309 AACAATCCACATATGGAAGGAGG + Intergenic
1011597500 6:89030024-89030046 AAGCTTCTGCATCTGGAGGAAGG - Intergenic
1013041520 6:106438604-106438626 AAGCAAACACATATGGATTATGG - Intergenic
1013300570 6:108801427-108801449 AAGCTTCCACTCATGGTGGAAGG + Intergenic
1013759386 6:113499188-113499210 ATGCATCCTCACATAGAGGAAGG + Intergenic
1013761972 6:113529434-113529456 ATGCAGCCACATTTGGAAGATGG + Intergenic
1016448698 6:144158599-144158621 AAGCATTCATAAATGTAGGATGG + Intronic
1016448707 6:144158739-144158761 AAGCATTCATAAATGTAGGATGG + Intronic
1016938872 6:149468480-149468502 AAGCAGTCACATATGGAGGAAGG + Intronic
1017807644 6:157959938-157959960 CTGCATCCTCACATGGAGGAAGG - Intergenic
1018999251 6:168734692-168734714 AAGCTTCCAATTATGGTGGAAGG + Intergenic
1019095716 6:169577501-169577523 AAGGGTCCACACGTGGAGGACGG + Intronic
1020810563 7:12845797-12845819 AAGCATCCCCAGAAGAAGGAAGG - Intergenic
1021246700 7:18271911-18271933 ATGCATCCATAAATGAAGGAAGG + Intronic
1021534295 7:21685609-21685631 ACCCATCCACATATGGAAGAAGG - Intronic
1023133165 7:37024041-37024063 AAGCACCCATAAATGGATGAAGG - Intronic
1023463225 7:40423703-40423725 AAACATACACATATAGAAGATGG - Intronic
1023532473 7:41172744-41172766 AAGCTTCCACTTATGGCAGAAGG - Intergenic
1023862129 7:44223075-44223097 AAACATGCACATAAGCAGGACGG + Intronic
1028477611 7:91267477-91267499 AACCTTCCAAATCTGGAGGAGGG + Exonic
1028567322 7:92246752-92246774 ATGCATCCAGATGGGGAGGATGG - Intronic
1031009096 7:116505545-116505567 AAGCTTCCACTTATAGTGGAAGG + Intronic
1031382255 7:121101711-121101733 AAGCTTCCACTGATGGTGGAAGG + Intronic
1033566226 7:142580818-142580840 TAGCATTCACCTTTGGAGGAAGG + Intergenic
1034043902 7:147907470-147907492 AAGCATCCACATAGGAAGGAGGG - Intronic
1035000720 7:155610353-155610375 AGGCATCCAGATATGGTGCAGGG + Intergenic
1036134558 8:6148218-6148240 AAGAAACCACACATGAAGGAAGG + Intergenic
1039318868 8:36405782-36405804 TAGCATCCAAAGATGGTGGAGGG - Intergenic
1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG + Intergenic
1040525649 8:48222241-48222263 AAGCTTCCACTCATGGTGGAAGG + Intergenic
1041598275 8:59683142-59683164 AAGCTTCCACTCATGGTGGAAGG - Intergenic
1042113416 8:65405729-65405751 AAGCATACACATAAGAAGGCTGG + Intergenic
1043066654 8:75579676-75579698 ACGCTTCCACTTATGGTGGAAGG - Intergenic
1044175722 8:89119394-89119416 AAGCTTCCACTCATGGAAGAGGG - Intergenic
1044520125 8:93189292-93189314 TAGCCAACACATATGGAGGAAGG - Intergenic
1044535996 8:93356990-93357012 AAGCATCCGCAGCTGGAGTATGG - Intergenic
1048841795 8:138573041-138573063 CTGCATCCTAATATGGAGGAAGG + Intergenic
1048917949 8:139202441-139202463 AAGCTTCCACTTATGGTGGAAGG + Intergenic
1051573447 9:18586116-18586138 AAGCATCCAAATAGGAAGAAAGG + Intronic
1053671647 9:40371116-40371138 ATGCATCCTCACATGGTGGAAGG + Intergenic
1053728138 9:41025196-41025218 TAGCATCCACATGTGGAAGACGG + Intergenic
1053781004 9:41606986-41607008 AAACATACACTTATGGTGGAAGG - Intergenic
1053921458 9:42997485-42997507 ATGCATCCTCACATGGTGGAAGG + Intergenic
1054168947 9:61817143-61817165 AAACATACACTTATGGTGGAAGG - Intergenic
1054382761 9:64511160-64511182 ATGCATCCTCACATGGTGGAAGG + Intergenic
1054512971 9:66005194-66005216 ATGCATCCTCACATGGTGGAAGG - Intergenic
1054668585 9:67763668-67763690 AAACATACACTTATGGTGGAAGG + Intergenic
1054700371 9:68406905-68406927 TAGTATCCACATGTGGAAGACGG - Intronic
1054949593 9:70835127-70835149 AAGCTTCCACTTATGGCAGAAGG - Intronic
1056694224 9:88832776-88832798 AAGCTTACAGTTATGGAGGAAGG + Intergenic
1057109104 9:92449792-92449814 AAGCATCCAATGATGGCGGAAGG - Intronic
1059462498 9:114442737-114442759 AAGCTTCCACTTATGGCAGAAGG - Intronic
1059643881 9:116244910-116244932 AAGCATCCATCAATGGATGATGG + Intronic
1059998120 9:119933522-119933544 AAGCTTCTACTTATGGTGGAAGG - Intergenic
1060618899 9:125044849-125044871 AGGCACCCACATCTGGACGAGGG - Intronic
1060731727 9:126041503-126041525 CTGCATCCTCATATGGTGGAAGG - Intergenic
1185742579 X:2545697-2545719 AAGCTTCCACTCATGGTGGAAGG - Intergenic
1185921423 X:4097135-4097157 AAGCTTCCACTCATGGTGGAAGG - Intergenic
1186093560 X:6075763-6075785 AAGCTTCCACTCATGGTGGAAGG - Intronic
1187686838 X:21824249-21824271 AAGCTTCCACTCATGGTGGAAGG + Intergenic
1188351749 X:29140049-29140071 AAGCATCCACTCATGGTAGAAGG + Intronic
1188455055 X:30354757-30354779 AAGCAACCACATATGCAAGCTGG - Intergenic
1188470771 X:30536780-30536802 AGGCATCCAAATAGGAAGGAAGG + Intergenic
1188875637 X:35426879-35426901 AAGAATCCAGGTATAGAGGAGGG + Intergenic
1189845474 X:45132458-45132480 AAGCTTCCACTCATGGTGGAAGG + Intergenic
1189851170 X:45177546-45177568 AAGCTTCCACTCATGGTGGAAGG - Intronic
1189891135 X:45603664-45603686 AAGCTTCCACTAATGGTGGAAGG - Intergenic
1190793871 X:53723590-53723612 AAGCTTCCACTTATGGCAGATGG - Intergenic
1192018153 X:67354461-67354483 CTGCATCCTCATATGGTGGAAGG + Intergenic
1192791324 X:74384224-74384246 CAGGCTCCACATATGCAGGAAGG + Intergenic
1192938216 X:75883309-75883331 AAGCTTCTCCATTTGGAGGAGGG + Intergenic
1193879371 X:86902349-86902371 AAACATACAATTATGGAGGAAGG - Intergenic
1193976831 X:88130980-88131002 AAGCTTCCAGTTATGGTGGAAGG - Intergenic
1194927242 X:99839982-99840004 AGGTATCCTCACATGGAGGAAGG - Intergenic
1195653884 X:107315649-107315671 AAGCCTCCACTTATGGCAGAAGG - Intergenic
1196868820 X:120094014-120094036 AAGCTTCCACTCATGGAGGAAGG + Intergenic
1197063621 X:122212830-122212852 AAGCTTCCAATTATGGGGGAAGG + Intergenic
1199159222 X:144587602-144587624 AAGAATCCACACAGGGAGCAGGG + Intergenic
1199279506 X:145983651-145983673 AAACTTGCACATATGTAGGATGG + Intergenic
1200052695 X:153443343-153443365 AAGCTTCCACTTATGGCAGAAGG - Intergenic
1202079764 Y:21072089-21072111 AGGCACCCACATCTGGACGATGG - Intergenic