ID: 1067739608

View in Genome Browser
Species Human (GRCh38)
Location 10:48884768-48884790
Sequence CTCCTCAGGAACCGTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067739599_1067739608 28 Left 1067739599 10:48884717-48884739 CCTCCCCTGTTTTTTTATCTTTG 0: 1
1: 0
2: 4
3: 146
4: 1791
Right 1067739608 10:48884768-48884790 CTCCTCAGGAACCGTTTCTCTGG No data
1067739602_1067739608 23 Left 1067739602 10:48884722-48884744 CCTGTTTTTTTATCTTTGTAACT 0: 1
1: 1
2: 2
3: 87
4: 1070
Right 1067739608 10:48884768-48884790 CTCCTCAGGAACCGTTTCTCTGG No data
1067739605_1067739608 -7 Left 1067739605 10:48884752-48884774 CCAGACTTGGAGTCACCTCCTCA 0: 1
1: 0
2: 8
3: 36
4: 247
Right 1067739608 10:48884768-48884790 CTCCTCAGGAACCGTTTCTCTGG No data
1067739601_1067739608 24 Left 1067739601 10:48884721-48884743 CCCTGTTTTTTTATCTTTGTAAC 0: 1
1: 0
2: 10
3: 108
4: 1367
Right 1067739608 10:48884768-48884790 CTCCTCAGGAACCGTTTCTCTGG No data
1067739604_1067739608 0 Left 1067739604 10:48884745-48884767 CCTAACTCCAGACTTGGAGTCAC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1067739608 10:48884768-48884790 CTCCTCAGGAACCGTTTCTCTGG No data
1067739600_1067739608 25 Left 1067739600 10:48884720-48884742 CCCCTGTTTTTTTATCTTTGTAA 0: 1
1: 0
2: 10
3: 165
4: 1884
Right 1067739608 10:48884768-48884790 CTCCTCAGGAACCGTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067739608 Original CRISPR CTCCTCAGGAACCGTTTCTC TGG Intronic
No off target data available for this crispr