ID: 1067741810

View in Genome Browser
Species Human (GRCh38)
Location 10:48901238-48901260
Sequence TAGGCCTTGAATATAATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 481}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067741810 Original CRISPR TAGGCCTTGAATATAATTTT AGG (reversed) Intronic
900847445 1:5115185-5115207 GAGGGCTGGAATTTAATTTTTGG - Intergenic
902050895 1:13562935-13562957 GAGGGCTGGAATCTAATTTTTGG - Intergenic
904310630 1:29627242-29627264 TAGGGCTTGAACATATTTTTTGG - Intergenic
905060545 1:35135974-35135996 GAGGGCTGGAATTTAATTTTTGG + Intergenic
905749392 1:40449252-40449274 TAGGGCTTCAAGATAAATTTTGG + Intergenic
907521234 1:55024667-55024689 GAGGGCTGGAATTTAATTTTTGG - Intergenic
908653048 1:66357563-66357585 TTGTTCTTGAATTTAATTTTTGG - Intronic
908912916 1:69093471-69093493 TAGGAATTCTATATAATTTTTGG - Intergenic
909180007 1:72411709-72411731 GTGGCCATTAATATAATTTTGGG - Intergenic
909229334 1:73065408-73065430 AATGGCTTAAATATAATTTTTGG + Intergenic
909909935 1:81247506-81247528 GAGGGCTGGAATTTAATTTTTGG - Intergenic
910534471 1:88281003-88281025 GATGCCTTGAATATAAATTCAGG - Intergenic
911148015 1:94570528-94570550 GAGGACTGGAATCTAATTTTTGG + Intergenic
911319281 1:96393085-96393107 TAGGACTTGAATATATATTTTGG - Intergenic
911759813 1:101601703-101601725 GAGGGCTGGAATTTAATTTTTGG + Intergenic
912010811 1:104959636-104959658 TAAGCCTTTAATCTATTTTTGGG - Intergenic
912186245 1:107279712-107279734 TTGGCTTGGAATATAATTCTGGG + Intronic
912296450 1:108475018-108475040 GAGGGCTGGAATTTAATTTTTGG - Intergenic
912369242 1:109160727-109160749 CTGGGCTTGAATATAGTTTTAGG + Intronic
912813535 1:112811480-112811502 GAGGGCTGGAATTTAATTTTTGG - Intergenic
912895481 1:113583374-113583396 TAGGACTTCATAATAATTTTGGG - Intronic
913295030 1:117311004-117311026 AAGGCCTTGAACACAACTTTAGG - Intergenic
914743350 1:150483294-150483316 TAGGCCCTTAGTAAAATTTTAGG - Intergenic
916135773 1:161652297-161652319 TACTCCTTGAATTTAAGTTTGGG + Intronic
916617430 1:166457173-166457195 AAAGCTTTGCATATAATTTTGGG + Intergenic
918305424 1:183241392-183241414 TAGGCCTGTGAGATAATTTTAGG + Intronic
919212634 1:194508461-194508483 TATGCCATAAATATATTTTTTGG - Intergenic
920537361 1:206747110-206747132 TAGGACTTGAACATAATTTTGGG + Intergenic
920789549 1:209076650-209076672 TAGGACTTGAACATATATTTTGG - Intergenic
920901555 1:210114456-210114478 GAGGGCTGGAATTTAATTTTTGG + Intronic
921029419 1:211324739-211324761 TAAGGCTTGGATGTAATTTTTGG + Intergenic
921603274 1:217130175-217130197 TTGATCTTGAATATCATTTTTGG + Intronic
921923389 1:220691782-220691804 TAGGACTTGAAGATATTTTGGGG + Intronic
922906373 1:229176486-229176508 GAGGGCTGGAATTTAATTTTTGG - Intergenic
923058229 1:230445662-230445684 TTGGCCTTGGCAATAATTTTTGG + Intergenic
923214222 1:231833881-231833903 GAGGGCTGGAATTTAATTTTTGG + Intronic
924180630 1:241436026-241436048 GAGGGCTGGAATTTAATTTTTGG - Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063206022 10:3831388-3831410 TAGGAATTGCTTATAATTTTTGG - Intergenic
1063509626 10:6633239-6633261 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1063625065 10:7681412-7681434 TAGGGCTTAAATAGTATTTTGGG - Intergenic
1063906250 10:10783170-10783192 TAGGACTTCAATATCATCTTGGG - Intergenic
1065437602 10:25718481-25718503 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1065850923 10:29787695-29787717 TGGGCATTTAATATAATTATTGG - Intergenic
1067741810 10:48901238-48901260 TAGGCCTTGAATATAATTTTAGG - Intronic
1068248228 10:54401552-54401574 GAGTCATTGAATATAATCTTCGG - Intronic
1068360753 10:55973266-55973288 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1068592370 10:58864662-58864684 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1073013994 10:100383796-100383818 GAGGGCTGGAATCTAATTTTTGG - Intergenic
1073683508 10:105729431-105729453 GAGGGCTGGAATCTAATTTTTGG - Intergenic
1074019000 10:109564405-109564427 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1074077161 10:110139501-110139523 TAGGCCTTAAAAATAATTGTGGG - Intergenic
1074397533 10:113110572-113110594 TTGTCCTTCACTATAATTTTGGG - Intronic
1074886688 10:117699544-117699566 TAGGACTTGAATATAACTTTTGG - Intergenic
1075158819 10:120004792-120004814 TAGGACTTGCATATATCTTTTGG + Intergenic
1076398456 10:130159727-130159749 GAGGCTGTGAATAAAATTTTTGG - Intronic
1078786669 11:14500823-14500845 TGGCCTTTGAATACAATTTTGGG - Intergenic
1079000355 11:16749084-16749106 TAAGCTTTTAAAATAATTTTAGG + Intronic
1079323098 11:19468647-19468669 TAGGACTTCAATATATCTTTTGG + Intronic
1079595433 11:22239269-22239291 TGGGCCGTGAATATTATATTAGG + Intronic
1079727097 11:23890825-23890847 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1079917520 11:26388170-26388192 TAGACCATAAATATAATTTTGGG - Intronic
1080020738 11:27557128-27557150 TATGTATTGAATATAATTTAAGG - Intergenic
1081093714 11:38904832-38904854 TAGTCCTAGAAGATAATATTTGG - Intergenic
1081356780 11:42122643-42122665 TAGGGCCGGAATTTAATTTTTGG - Intergenic
1081737887 11:45417085-45417107 TAGGACTTGGACATAATTTTGGG - Intergenic
1082204604 11:49417872-49417894 TAGGACTTTAATAAAATTTGGGG - Intergenic
1085439978 11:76551796-76551818 TAGACTTTGCATACAATTTTAGG + Exonic
1085934243 11:81123891-81123913 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1085987989 11:81808255-81808277 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1086125333 11:83343756-83343778 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1086650487 11:89282643-89282665 TAGGACTTTAATAAAATTTGGGG + Intronic
1087099614 11:94351692-94351714 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1088394152 11:109348342-109348364 TAAGCCATGAATGTAAGTTTTGG - Intergenic
1089471081 11:118720644-118720666 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1089987659 11:122829189-122829211 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1090061390 11:123467054-123467076 TAGGCCTAGAATTTTATTGTAGG + Intergenic
1090782542 11:130020768-130020790 TAGACCTTGAATATCTTTTTAGG + Intergenic
1090850622 11:130568008-130568030 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1090986078 11:131767446-131767468 TAGGGTTTCAATATAAATTTGGG - Intronic
1091474827 12:762653-762675 TATGCCTTTAATCTATTTTTGGG - Intronic
1091681425 12:2530220-2530242 AAGGCATGGAAAATAATTTTTGG - Intronic
1092474463 12:8807004-8807026 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1092592780 12:9966739-9966761 GAGGACTGGAATTTAATTTTTGG + Intronic
1092723745 12:11465815-11465837 GAGGGCTGGAATTTAATTTTTGG + Intronic
1093071188 12:14708515-14708537 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1093264351 12:16984010-16984032 TAATCCTTTAAAATAATTTTTGG + Intergenic
1093418291 12:18945869-18945891 TTGGACTGGAATAGAATTTTAGG + Intergenic
1093812865 12:23509683-23509705 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1093817520 12:23567999-23568021 TAGGACTTGGATATATCTTTTGG - Intronic
1094400644 12:30058016-30058038 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1095366275 12:41410058-41410080 TAGGACTTCAACATATTTTTTGG + Intronic
1097560390 12:61198001-61198023 TAGGACTTCAACATATTTTTTGG - Intergenic
1097671112 12:62539574-62539596 TAGTCCTTAAGTGTAATTTTGGG + Intronic
1098011820 12:66061434-66061456 TAGGGTTTGAATACATTTTTGGG - Intergenic
1098484481 12:71004814-71004836 TAGCACTTGAACATAACTTTTGG - Intergenic
1098591471 12:72218898-72218920 TAGGACTTGGACATAACTTTTGG + Intronic
1098629035 12:72705416-72705438 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1098630055 12:72712539-72712561 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1098653856 12:73005631-73005653 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1098919885 12:76293500-76293522 GAGGGCTAGAATCTAATTTTTGG - Intergenic
1099836124 12:87911057-87911079 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1100620194 12:96263812-96263834 TGGGCCTTGAATATAGGCTTAGG + Intronic
1100790669 12:98126564-98126586 TAGGACTTCAATATATCTTTTGG + Intergenic
1102113362 12:110382023-110382045 AGGGCCTTCAATATGATTTTTGG - Intronic
1103333544 12:120171886-120171908 TAGACTTTTTATATAATTTTTGG + Intronic
1103814462 12:123642529-123642551 TAGGACTTGAACATATCTTTTGG + Intronic
1103895710 12:124271821-124271843 TAGGACTTGAGTATATCTTTAGG + Intronic
1103965118 12:124633816-124633838 CAGACATTAAATATAATTTTAGG - Intergenic
1106748237 13:32727563-32727585 TTTGCTTGGAATATAATTTTAGG + Intronic
1106883265 13:34155073-34155095 TAGGCCTTGAAAGTAAAATTTGG - Intergenic
1106908686 13:34439088-34439110 TAGGACTTGAAGATATCTTTTGG + Intergenic
1106943418 13:34800710-34800732 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1107400127 13:40061516-40061538 TTGGACTTGAATTTTATTTTAGG - Intergenic
1108827347 13:54429940-54429962 TAGGCCAAGAATACAAATTTAGG - Intergenic
1108919571 13:55658619-55658641 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1109343553 13:61090396-61090418 GAGGGCTGGAATTTAATTTTGGG - Intergenic
1109392069 13:61706480-61706502 CAGGACTTGAATCTAGTTTTAGG - Intergenic
1110978462 13:81868215-81868237 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1111341691 13:86894987-86895009 TAGGACTTCAACATATTTTTGGG + Intergenic
1111771514 13:92602037-92602059 AATGCCTTGAAAATAATTGTTGG + Intronic
1112174716 13:97010671-97010693 TAGGACTTCAATATATCTTTTGG + Intergenic
1112444156 13:99448555-99448577 TAGGACTCGCATACAATTTTTGG - Intergenic
1113415970 13:110129041-110129063 TAGGACTTCAACATCATTTTTGG - Intergenic
1114049426 14:18910468-18910490 TAGATCTAGAATATAATTATTGG - Intergenic
1114113137 14:19491463-19491485 TAGATCTAGAATATAATTATTGG + Intergenic
1115007378 14:28501838-28501860 AAAGCCTTAAATATAAATTTTGG + Intergenic
1115676483 14:35681000-35681022 TAGGTCATGAATATCATTATAGG - Intronic
1115762986 14:36594151-36594173 TAGTACTTGAATATATATTTTGG + Intergenic
1116388546 14:44362508-44362530 TGGACCTTGTAAATAATTTTGGG + Intergenic
1116446410 14:45017276-45017298 AAGGCTTTGTATATGATTTTTGG + Intronic
1116702433 14:48259052-48259074 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1117242152 14:53844896-53844918 TAGGCCTTGAATCAGATTTCTGG - Intergenic
1117429253 14:55636559-55636581 TAAACTTTGTATATAATTTTGGG + Intronic
1117662512 14:58022053-58022075 TAGGCCATGAGTCTGATTTTTGG - Intronic
1117957942 14:61137094-61137116 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1118441328 14:65814367-65814389 GAGGCCTAGAATTTTATTTTTGG + Intergenic
1119474761 14:74920585-74920607 TAGGCCTTGAATGTTCTTTCTGG + Intronic
1121224747 14:92313074-92313096 AAGACCTTGAATATAATTTCTGG - Intergenic
1121383568 14:93495752-93495774 TAGGCCTGGAATATAGATTAGGG + Intronic
1121425728 14:93850426-93850448 TAGGGCTTGAATATATCTTTTGG + Intergenic
1121980610 14:98450795-98450817 GAGGGCTGGAATGTAATTTTTGG + Intergenic
1122040970 14:98987266-98987288 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1122381347 14:101309316-101309338 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1124050856 15:26196514-26196536 TAGGACATGAATATATTTTTAGG - Intergenic
1124958332 15:34374927-34374949 GAAGCCTAGAATATTATTTTTGG - Intergenic
1126893611 15:53234145-53234167 TATGCCTTGAAGATAAACTTAGG + Intergenic
1127321695 15:57852936-57852958 TAGGACTTCAATATGAATTTGGG - Intergenic
1130855088 15:87833335-87833357 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1130880808 15:88054189-88054211 TAGGCATTCAATATATTTTTTGG - Intronic
1131017037 15:89066537-89066559 TAGGACTTGAACATATATTTTGG + Intergenic
1131297159 15:91159256-91159278 TAGCTCTTGGATATAATGTTCGG + Intronic
1131447718 15:92513551-92513573 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1131684152 15:94752815-94752837 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1133651372 16:7816771-7816793 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1137363407 16:47840580-47840602 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1138262557 16:55635664-55635686 TAGGCTTAGAATTTTATTTTTGG + Intergenic
1138916938 16:61475943-61475965 TATGTCTTCAATATACTTTTTGG - Intergenic
1139007323 16:62588555-62588577 TAAGACTTTAATATAATCTTTGG + Intergenic
1139225941 16:65233477-65233499 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1139730008 16:68935514-68935536 TAGGAGTTAAATTTAATTTTAGG + Intronic
1139943077 16:70620109-70620131 CAGGGCTGGAATTTAATTTTTGG + Intronic
1140568399 16:76072332-76072354 TAGGCCTTTAACATACTTTTGGG + Intergenic
1140595821 16:76409556-76409578 TTGCCTTTGCATATAATTTTTGG - Intronic
1140604184 16:76515288-76515310 TAGGGCTTCAACATAAATTTTGG - Intronic
1140799121 16:78468921-78468943 TCGCTCTTGAATATACTTTTGGG - Intronic
1143290537 17:5824588-5824610 CAGGCCTTGCATCTAATTTCTGG - Intronic
1143414372 17:6735260-6735282 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1145873094 17:28292875-28292897 TAGGCATTGCATGTAATTTCTGG - Intergenic
1146240130 17:31213639-31213661 TAGCTCTGGAATATAATTGTTGG + Intronic
1148290018 17:46437445-46437467 TAGGCATTGAAAATTATTATGGG + Intergenic
1148291687 17:46457163-46457185 TAGGTCATGAATATATTTTCAGG + Intergenic
1148312186 17:46655017-46655039 TAGGCATTGAAAATTATTATGGG + Intronic
1148313877 17:46674870-46674892 TAGGTCATGAATATATTTTCAGG + Intronic
1149240806 17:54646669-54646691 TAGGCATTTAATATTATTTGTGG - Intergenic
1149325200 17:55522910-55522932 TAAGCATTGAATATATATTTGGG + Intergenic
1149756672 17:59191988-59192010 TAGGACTTGAATATACCTTTTGG - Intronic
1150318767 17:64192198-64192220 TAGGACTTTAACATATTTTTTGG - Intronic
1151908928 17:77068680-77068702 TAGGACTTGAACATATCTTTTGG + Intergenic
1152341006 17:79724867-79724889 CAGGCCTAGATTATATTTTTTGG - Intergenic
1152502967 17:80725373-80725395 ATGGCCTTGAATATGATTCTTGG + Intronic
1155972677 18:32096181-32096203 TAGACCTAGTAAATAATTTTTGG + Intronic
1156144577 18:34159719-34159741 TAGTCCTCGAAGATAATTCTAGG - Intronic
1156237328 18:35217811-35217833 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1156251959 18:35359976-35359998 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1156302218 18:35845940-35845962 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1156938504 18:42738695-42738717 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1158107308 18:53900302-53900324 TAAGCCTTAAAAATAAGTTTTGG + Intergenic
1158394668 18:57070268-57070290 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1160026269 18:75219388-75219410 AAAGCAATGAATATAATTTTTGG + Intronic
1161712015 19:5854151-5854173 GAGGGCTGGAATCTAATTTTTGG - Intergenic
1162597118 19:11638182-11638204 TGGGCTTTGAATTTTATTTTTGG + Intergenic
1164080778 19:21859826-21859848 GAGGGCTGGAATCTAATTTTTGG - Intergenic
1164202525 19:23030462-23030484 GAGGGCCAGAATATAATTTTTGG + Intergenic
925518579 2:4713923-4713945 TAGACCTTCAATATAAAATTAGG - Intergenic
925828846 2:7876303-7876325 GAGGGCTGGAATTTAATTTTTGG + Intergenic
929004859 2:37384638-37384660 GAGGGCTGGAATTTAATTTTTGG + Intergenic
929025893 2:37601266-37601288 TATTTCTTGAATATAATTTTTGG - Intergenic
930329955 2:49970041-49970063 AATGACTTGAATATTATTTTGGG - Intronic
931211050 2:60195405-60195427 TTTGCCTTCCATATAATTTTTGG - Intergenic
931258495 2:60596419-60596441 TAGGACTTGAAATGAATTTTGGG - Intergenic
931625748 2:64254597-64254619 GAGGGCTGGAATTTAATTTTTGG - Intergenic
932630870 2:73342201-73342223 CAGAACTAGAATATAATTTTGGG + Intergenic
932854236 2:75217434-75217456 GAGGGCTGGAATTTAATTTTTGG + Intergenic
932949027 2:76271143-76271165 TAGGACTTCAACATAAATTTTGG + Intergenic
933137907 2:78759940-78759962 GAGGGCTGGAATCTAATTTTTGG - Intergenic
933163704 2:79053456-79053478 GAGGGCTGGAATTTAATTTTTGG - Intergenic
933179797 2:79215487-79215509 GAGGGCTGGAATTTAATTTTTGG + Intronic
933897196 2:86822464-86822486 AATGCATTCAATATAATTTTAGG + Intronic
934546031 2:95217296-95217318 TAGGACTTCAACAAAATTTTGGG + Intronic
934888544 2:98046132-98046154 TAGGACTTCAATATCATTTGAGG + Intergenic
935006474 2:99083507-99083529 TATGCATTTAATATAATTATTGG - Intronic
936781966 2:116044100-116044122 TCCGCCTTGAATATAAATGTTGG + Intergenic
936870765 2:117132361-117132383 GAGGGCTGGAATCTAATTTTTGG - Intergenic
937531570 2:122835288-122835310 TATGCCTTGTATAAAATTCTTGG + Intergenic
938426774 2:131198805-131198827 TAGATCTAGAATATAATTGTTGG - Intronic
938542388 2:132295096-132295118 TAGGACTTGAACATATTTTTGGG + Intergenic
939083167 2:137686611-137686633 GAGGGCTGGAATTTAATTTTTGG + Intergenic
940508822 2:154586904-154586926 GAGGGCTGGAATTTAATTTTTGG + Intergenic
940726464 2:157341775-157341797 GAGGCCCGGAATATAATTTTTGG + Intergenic
941146391 2:161851848-161851870 TTGTACTTGAGTATAATTTTTGG + Intronic
941500113 2:166263640-166263662 TAGGACTTCAACATAACTTTTGG - Intronic
941935920 2:170981302-170981324 GAGGGCTGGAATTTAATTTTTGG + Intergenic
942097056 2:172543781-172543803 GAGGGCTGGAATTTAATTTTTGG - Intergenic
943039427 2:182786813-182786835 TAGGATTTCAACATAATTTTAGG - Exonic
943533274 2:189114603-189114625 TGGGCCTTGAATCTAAGCTTTGG - Intronic
943865318 2:192920102-192920124 GAGGGCTGGAATTTAATTTTTGG - Intergenic
944283116 2:197921435-197921457 TATGCCTTGATTATAAATATTGG + Intronic
944410538 2:199437809-199437831 TAGGCCTTGAAAAAAATTACTGG - Intronic
944614606 2:201447741-201447763 TAGGGCTTCAATATAATTTTGGG + Intronic
944876154 2:203965558-203965580 GAGGGCTGGAATTTAATTTTTGG + Intergenic
945301512 2:208219904-208219926 GAGGGCTGGAATTTAATTTTTGG + Intergenic
945361618 2:208901284-208901306 GAGGGCTGGAATTTAATTTTTGG - Intergenic
945947886 2:216012156-216012178 AAGGCCTTGAAAATAGCTTTTGG + Intronic
946078196 2:217093309-217093331 TAGGACTTGAACATATTTTTAGG - Intergenic
946511084 2:220357241-220357263 TAGGACTTGCATAAAAGTTTGGG - Intergenic
946781073 2:223193509-223193531 GAGGGCTGGAATTTAATTTTTGG + Intronic
948503036 2:238408716-238408738 CAGGGTTTGAATAAAATTTTTGG - Intergenic
1168884053 20:1232682-1232704 TAGGTTTTGCATATAAGTTTTGG + Intronic
1169908426 20:10626438-10626460 AGGGACTTGAATATAATTTGGGG - Exonic
1170106208 20:12755941-12755963 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1170500383 20:16969716-16969738 TAGGACTTGAACATATCTTTTGG + Intergenic
1170680463 20:18521265-18521287 AAGGGCTGGAATCTAATTTTTGG + Intronic
1171871266 20:30527940-30527962 TAGGACTTGAACATATTTTTGGG + Intergenic
1176678770 21:9806041-9806063 TAGACCGTTAATATAATTGTTGG - Intergenic
1177031203 21:15983458-15983480 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1177063042 21:16397003-16397025 GAGGGCTGGAATCTAATTTTTGG + Intergenic
1177663440 21:24119379-24119401 TAGACCATGAAAAGAATTTTGGG + Intergenic
1178476078 21:32938494-32938516 TAGGACTTGAACATATCTTTTGG + Intergenic
1179015312 21:37590679-37590701 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1179076683 21:38128908-38128930 TAGGACTTGAACATATCTTTTGG - Intronic
1180467909 22:15632845-15632867 TAGATCTAGAATATAATTGTTGG - Intergenic
1181351813 22:22264308-22264330 TAGGCCCTGTTTATAATTTGAGG + Intergenic
1181720123 22:24767786-24767808 TATGCCTAGAGTATAATTTTTGG - Intronic
1181817910 22:25453108-25453130 TGTGCCCTAAATATAATTTTGGG + Intergenic
1182053908 22:27334701-27334723 TAGGACTTTAATATATTCTTTGG + Intergenic
1183132528 22:35852901-35852923 TAGGCCTTCAATAACATTTGGGG - Intronic
1183297837 22:37042564-37042586 TTCGCTTTGAAAATAATTTTAGG - Intergenic
949134552 3:547771-547793 TTGGCATTTAATATAATTTAGGG - Intergenic
949670633 3:6395866-6395888 TAGGAGTTGGATATGATTTTAGG + Intergenic
949671124 3:6399722-6399744 GAGGGCTGGAATTTAATTTTTGG - Intergenic
949733207 3:7138904-7138926 TATGCCTTTAATATCTTTTTGGG - Intronic
949827414 3:8179085-8179107 GAGGGCTAGAATTTAATTTTTGG - Intergenic
951889007 3:27551795-27551817 GAGGGCTGGAATTTAATTTTTGG + Intergenic
952896083 3:38079921-38079943 GAGGGCTGGAATTTAATTTTTGG + Intronic
953038822 3:39237002-39237024 TAGGACTTGAATATATTTTTGGG - Intergenic
953177168 3:40563060-40563082 GAGGGCTGGAATTTAATTTTTGG - Intronic
953656593 3:44859352-44859374 GAGGGCTGGAATCTAATTTTTGG + Intronic
953841194 3:46391405-46391427 GAGGGCTGGAATCTAATTTTTGG + Intergenic
953976712 3:47387072-47387094 GAGGCCTTGAGTATTATTGTAGG + Intronic
955019675 3:55107169-55107191 TATGCCTTGAATATACTTTCAGG + Intergenic
955284457 3:57625467-57625489 AAGGCCTTTAATTTAGTTTTTGG + Exonic
955326565 3:58013185-58013207 TAGGCCTTGATCATCATTCTTGG - Intronic
957346203 3:78964293-78964315 TAGGCCTTCAACAACATTTTGGG + Intronic
957415783 3:79901698-79901720 TATGCATTAAAAATAATTTTAGG - Intergenic
957594509 3:82244883-82244905 AAGGCCTTTAAAATCATTTTGGG - Intergenic
957904876 3:86542090-86542112 GAGGGCTGGAATCTAATTTTTGG + Intergenic
958750977 3:98193041-98193063 GAGGGCTGGAATTTAATTTTTGG - Intronic
959018851 3:101166675-101166697 TAGGACTTGAACATATCTTTTGG - Intergenic
959485798 3:106926371-106926393 GAGGGCTGGAATTTAATTTTTGG + Intergenic
959791259 3:110364870-110364892 TTGGCCTTCAATATAATTTATGG + Intergenic
961064951 3:123867284-123867306 TAGGACTTCAATAAGATTTTTGG - Intronic
961203427 3:125062249-125062271 TAGGGCTTGAACATATCTTTTGG + Intergenic
962313397 3:134341929-134341951 TAGGACTTGAGCATATTTTTTGG - Intergenic
962772323 3:138624242-138624264 CAGGCCTTTAAATTAATTTTAGG + Intronic
963318300 3:143784780-143784802 TAGGATTTCAGTATAATTTTGGG - Intronic
963456690 3:145554817-145554839 GAGGGCTGGAATTTAATTTTTGG + Intergenic
963521595 3:146364096-146364118 GAGGGCTGGAATTTAATTTTTGG - Intergenic
964300287 3:155278850-155278872 GAGGGCTGGAATTTAATTTTTGG + Intergenic
964983607 3:162714444-162714466 GAGGGCTGGAATTTAATTTTTGG - Intergenic
964984899 3:162726187-162726209 GAGGGCTGGAATTTAATTTTTGG + Intergenic
965077003 3:163991686-163991708 TTGGCCTTGGAAATAATTTCTGG - Intergenic
965105256 3:164345788-164345810 GAGGGCTGGAATTTAATTTTTGG + Intergenic
965262683 3:166504454-166504476 GAGGGCTGGAATTTAATTTTTGG + Intergenic
965336298 3:167433256-167433278 GAGGGCTGGAATTTAATTTTTGG - Intergenic
965487778 3:169299447-169299469 TAGGCCTGGAGTATAAGATTAGG + Intronic
965624912 3:170676186-170676208 CAGGGCTGGAATTTAATTTTTGG + Intronic
965628225 3:170703744-170703766 TTGGCCTCCAAAATAATTTTTGG + Intronic
966066817 3:175829782-175829804 GAGGGCTGGAATTTAATTTTTGG - Intergenic
966279271 3:178209573-178209595 GAGGGCTGGAATTTAATTTTTGG - Intergenic
966520335 3:180867969-180867991 TGGGCATAGAATATTATTTTGGG + Intronic
967244197 3:187469913-187469935 GAGGGCTGGAATTTAATTTTTGG + Intergenic
969654130 4:8486443-8486465 GAGGGCTGGAATTTAATTTTTGG + Intronic
969749026 4:9096300-9096322 GAGGGCTGGAATTTAATTTTTGG - Intergenic
970029267 4:11657401-11657423 GAGGGCTGGAATTTAATTTTTGG + Intergenic
970042059 4:11808314-11808336 GAGGGCTGGAATTTAATTTTTGG - Intergenic
970377437 4:15473525-15473547 TAGGCCTTGGAAAAAACTTTGGG + Intronic
970532705 4:16999732-16999754 GAGGGCTGGAATTTAATTTTTGG - Intergenic
970880973 4:20930442-20930464 TTGGCCTTGGAGATGATTTTTGG + Intronic
971233071 4:24816413-24816435 AATGACTTGAGTATAATTTTGGG - Intronic
971494898 4:27253304-27253326 TAGGGCTTTAACATATTTTTGGG + Intergenic
971514540 4:27469868-27469890 TAGTCCTTTAATATAATTTCTGG - Intergenic
971721380 4:30249211-30249233 TAGCCTTTTAATATAATTTGAGG + Intergenic
973752231 4:54032697-54032719 TATGGATTGACTATAATTTTGGG - Intronic
973937174 4:55858225-55858247 TATGATTTGAAAATAATTTTTGG - Intronic
974230452 4:59106551-59106573 TTGGACTTGAATATATTCTTTGG + Intergenic
974695960 4:65371570-65371592 TAGTTCTTGAGTATAAATTTGGG + Intronic
974758049 4:66238237-66238259 AAGCTCTTGAATTTAATTTTGGG - Intergenic
974883808 4:67791767-67791789 TTGGCCTTGGCAATAATTTTTGG + Intergenic
975075571 4:70204190-70204212 CATGCCTTGGATATAATTTTAGG + Exonic
975654433 4:76627591-76627613 TAGGCTTTGTGGATAATTTTAGG - Intronic
977012953 4:91658268-91658290 GAGGGCTGGAATTTAATTTTTGG + Intergenic
977192322 4:94016315-94016337 TAGTACTTGTATATATTTTTGGG + Intergenic
977225371 4:94387114-94387136 GAGGGCTGGAATTTAATTTTTGG + Intergenic
977270696 4:94914358-94914380 TAGGCCTTGAAGAGAGATTTGGG + Intronic
977907836 4:102499010-102499032 TAGGACTTGAACATATGTTTTGG - Intergenic
978178531 4:105764741-105764763 TAGGCTTTTAACATAATTTTTGG + Intronic
978438583 4:108711092-108711114 GAGGGCTGGAATTTAATTTTTGG - Intergenic
978460012 4:108941159-108941181 TAGGCTTTTAATATCTTTTTTGG + Intronic
978807870 4:112819448-112819470 TAGGCATTGAAGAAACTTTTGGG + Intronic
979146591 4:117254165-117254187 GAGGGCTGGAATTTAATTTTTGG - Intergenic
979317611 4:119283220-119283242 TCTGTCTTGAATATAATTTAAGG - Intronic
980111958 4:128644481-128644503 GAGGGCTGGAATTTAATTTTTGG + Intergenic
980251081 4:130315586-130315608 TAGGCCTTGCAAATGAGTTTTGG - Intergenic
980388897 4:132120265-132120287 GAGGCCCGGAATTTAATTTTTGG - Intergenic
980487711 4:133480781-133480803 TAAGCATACAATATAATTTTCGG - Intergenic
980491377 4:133532825-133532847 GAGGGCTGGAATCTAATTTTTGG + Intergenic
981040216 4:140215559-140215581 GAGGGCTGGAATTTAATTTTTGG - Intergenic
981949428 4:150388289-150388311 TAGGGCTCCAACATAATTTTCGG + Intronic
982318782 4:154058318-154058340 GAGGGCTGGAATCTAATTTTTGG - Intergenic
983023843 4:162711167-162711189 GAGGGCTGGAATTTAATTTTTGG - Intergenic
983312796 4:166086660-166086682 AAGCCCTTGAATGTAACTTTCGG + Intronic
983707641 4:170679530-170679552 GAGGGCTGGAATTTAATTTTTGG - Intergenic
984165387 4:176298520-176298542 GAGGGCTGGAATTTAATTTTTGG + Intergenic
984344758 4:178508477-178508499 GAGGTCTTGAGCATAATTTTTGG + Intergenic
984411696 4:179405256-179405278 GAGGGCTGGAATCTAATTTTTGG - Intergenic
984797883 4:183681846-183681868 TTGACCTAGAATTTAATTTTTGG + Intronic
985079029 4:186245778-186245800 GAGGGCTGGAATCTAATTTTTGG + Intronic
985396784 4:189552904-189552926 TAGACCGTTAATATAATTGTTGG + Intergenic
985582329 5:704855-704877 GAGGGCTGGAATTTAATTTTTGG - Intergenic
986112369 5:4731940-4731962 TAGGACTTCAAGATAAATTTGGG + Intergenic
986463939 5:8001963-8001985 TAGGCTTTAGTTATAATTTTGGG - Intergenic
987134601 5:14889220-14889242 TAGGATTTGAATATATGTTTTGG + Intergenic
988724475 5:33912372-33912394 TAGGACTTGAACATATCTTTTGG - Intergenic
988976314 5:36519955-36519977 TAGCCTTTGCAGATAATTTTGGG - Intergenic
989070686 5:37507791-37507813 TAGGACTTTAAAATATTTTTTGG + Intronic
989422801 5:41259671-41259693 TGGGCCTTAACTCTAATTTTAGG + Intronic
989688926 5:44118380-44118402 GAGGACTGGAATCTAATTTTTGG + Intergenic
990565150 5:57020653-57020675 GAGGGCTGGAATCTAATTTTTGG + Intergenic
990644546 5:57829469-57829491 TAGGACTTGAATATATATTTTGG - Intergenic
991101118 5:62794307-62794329 TAAGGCTTGTATGTAATTTTTGG - Intergenic
991314433 5:65284394-65284416 TAAGCCTTGAATAAAAATATGGG - Intronic
993180325 5:84544208-84544230 TAGGGCTTGAACATATCTTTTGG + Intergenic
993486577 5:88494837-88494859 TAGGACTTCAATATATTTTGCGG - Intergenic
994126137 5:96170545-96170567 GAGGGCTGGAATTTAATTTTTGG + Intergenic
994866988 5:105286938-105286960 TTTGCCATTAATATAATTTTGGG - Intergenic
995769351 5:115652566-115652588 GAGGGCTGGAATCTAATTTTTGG - Intergenic
996087904 5:119322821-119322843 TGGGCCTGGAATGTAAGTTTGGG - Intronic
996358656 5:122622539-122622561 GAGGGCTGGAATTTAATTTTTGG + Intergenic
996575032 5:124970268-124970290 GAGGGCTGGAATTTAATTTTTGG + Intergenic
997181055 5:131829647-131829669 TAGGACTTCAACATATTTTTTGG - Intronic
998693733 5:144615010-144615032 GAGGGCTGGAATTTAATTTTTGG + Intergenic
998868113 5:146526044-146526066 TAGGCCTGGAATTTAATTCCAGG + Intergenic
1000606902 5:163336085-163336107 GAGGGCTGGAATCTAATTTTTGG - Intergenic
1000916979 5:167094417-167094439 TAGTCATTCAATATATTTTTGGG + Intergenic
1000935674 5:167301560-167301582 GAGGGCTGGAATTTAATTTTTGG + Intronic
1002610993 5:180418371-180418393 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1003112369 6:3260713-3260735 TAGGACTTCAACATATTTTTTGG + Intronic
1003266918 6:4574042-4574064 TAAGCCATCAATATAAGTTTTGG - Intergenic
1003805184 6:9720366-9720388 TAAATCTTAAATATAATTTTAGG - Intronic
1004089927 6:12490429-12490451 TAGGCCTAAAATATAATCTGGGG + Intergenic
1004508025 6:16262638-16262660 GAGGGCTGGAATTTAATTTTTGG + Intronic
1004575194 6:16888021-16888043 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1004748752 6:18539273-18539295 TAGTACTTGAATATCATGTTTGG - Intergenic
1005014687 6:21365153-21365175 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1007189768 6:40003555-40003577 TAGGTCTTCAATATAAATTGGGG + Intergenic
1007523422 6:42469628-42469650 TTGGCATTTAATGTAATTTTTGG + Intergenic
1007709894 6:43816036-43816058 TCTGCCTTGAATATAATTATAGG - Intergenic
1008207011 6:48672962-48672984 TTGGCTTTGTATATAATTTGTGG - Intergenic
1008366881 6:50691448-50691470 TAGTCAAAGAATATAATTTTAGG - Intergenic
1009464311 6:63951971-63951993 GAGGGCTGGAATCTAATTTTTGG - Intronic
1009507091 6:64498322-64498344 TAGGTCCTGAAAACAATTTTTGG + Intronic
1009545796 6:65018585-65018607 TAGGACAACAATATAATTTTGGG + Intronic
1010071753 6:71752220-71752242 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1010638832 6:78296453-78296475 TAGGCATTTAATTTTATTTTTGG - Intergenic
1010829724 6:80513978-80514000 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1011183310 6:84646347-84646369 TAGGATTTGAATATAAATGTTGG - Intergenic
1011367924 6:86602009-86602031 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1012066574 6:94557592-94557614 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1012675073 6:102104023-102104045 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1014555818 6:122841893-122841915 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1014612053 6:123558680-123558702 GAGGGCTGGAATTTAATTTTTGG - Intronic
1014698514 6:124654568-124654590 TAGGCCATAAACATAAGTTTAGG - Intronic
1014775643 6:125506544-125506566 TAGACCTTCAATATGAATTTTGG - Intergenic
1015288065 6:131507927-131507949 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1015314716 6:131805810-131805832 TTGTCCTTGAATCTGATTTTTGG + Intergenic
1016114170 6:140261056-140261078 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1016248834 6:142017872-142017894 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1017019075 6:150125842-150125864 TAGGACTTCAACATATTTTTTGG - Intergenic
1017787984 6:157772274-157772296 TAGGACTTGAACATATCTTTTGG - Intronic
1018077565 6:160230533-160230555 GAGGGCTGGAATTTAATTTTTGG - Intronic
1018495431 6:164342376-164342398 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1018674149 6:166204696-166204718 TAGGCCTTGAAAATCATTCTTGG - Intergenic
1019509408 7:1409928-1409950 TAGGACTTCAACATATTTTTTGG + Intergenic
1019986740 7:4662377-4662399 TCAGCTTTGATTATAATTTTAGG + Intergenic
1020419949 7:7991546-7991568 TTGGCCTTGAAAATAATTTTAGG + Intronic
1020541171 7:9462201-9462223 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1020933919 7:14435621-14435643 ATGGCATTGAATATAATGTTGGG - Intronic
1021225409 7:18020653-18020675 TGGGCCTTAAATATCATTATAGG - Intergenic
1021393591 7:20122640-20122662 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1021429817 7:20547513-20547535 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1022157801 7:27677845-27677867 AAAGTCTTGAATGTAATTTTTGG - Intergenic
1024379568 7:48680597-48680619 TAGACCTTGAAAATATATTTTGG - Intergenic
1026664230 7:72328655-72328677 AATGCCTTGAATAGAATGTTGGG - Intronic
1028354539 7:89889433-89889455 TAGGACTTGGATATATGTTTTGG + Intergenic
1028853323 7:95561632-95561654 TAGGACTTCAATATCTTTTTTGG - Intergenic
1029317136 7:99725308-99725330 GAGGCCTGGAATCCAATTTTTGG - Intronic
1031355223 7:120780789-120780811 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1031422485 7:121567652-121567674 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1031525564 7:122818985-122819007 GAGGGCTGGAATTTAATTTTTGG - Intronic
1032347768 7:131132997-131133019 TGTGCCTTGCATATATTTTTAGG + Intronic
1033211490 7:139463314-139463336 GAGGGCTGGAATCTAATTTTTGG - Intronic
1034457142 7:151176768-151176790 TAGGTCTTCAATATATCTTTTGG - Intronic
1034495455 7:151418705-151418727 TAGGCCTTGAATTTTCTTTGTGG - Intergenic
1034621734 7:152462337-152462359 TAGGCCTTGAATGTCATGATGGG + Intergenic
1035880694 8:3241889-3241911 GAGGGCTGGAATTTAATTTTTGG + Intronic
1036050749 8:5193779-5193801 TAGGAATTTCATATAATTTTGGG - Intergenic
1036070956 8:5440309-5440331 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1037119944 8:15271224-15271246 TTGGCCTTGACGATAATTTCTGG + Intergenic
1037431831 8:18821497-18821519 TAGGCCTTGATTATAAATACTGG - Intronic
1038004615 8:23419056-23419078 TAGGACTTCAACATAACTTTTGG - Intronic
1038382011 8:27105179-27105201 TAGGACTTTAACACAATTTTGGG - Intergenic
1038605885 8:29004004-29004026 AAGGACATGAAAATAATTTTAGG + Intronic
1039677648 8:39687287-39687309 TATGCATTGTAAATAATTTTAGG - Intronic
1040944637 8:52871095-52871117 TAGGCCTTTAATCTACTTTTAGG + Intergenic
1041338925 8:56821523-56821545 TAAGTCATGAATATGATTTTTGG + Intergenic
1041401575 8:57450786-57450808 TTGGCCTTGAAAATAATGTCAGG + Intergenic
1041670879 8:60490755-60490777 CAGCTCTTGAATAGAATTTTTGG + Intergenic
1041861867 8:62523597-62523619 TAGGACTGGAATATGTTTTTAGG + Intronic
1042464886 8:69117453-69117475 TAGGACTTGAACACAATTTTTGG - Intergenic
1042591168 8:70400928-70400950 TATCCCATGAATTTAATTTTGGG - Intronic
1042761667 8:72277723-72277745 TAGGCACTGAATATAAGATTGGG - Intergenic
1043598816 8:81915489-81915511 GAGGGCTGGAATCTAATTTTTGG - Intergenic
1043922495 8:85999396-85999418 TGGGACTAGAATACAATTTTGGG + Intronic
1043973506 8:86559725-86559747 TAGGCCCTCAATAAAATATTAGG - Exonic
1044463610 8:92478019-92478041 GAGGCCTTGAATAGAAAATTCGG + Intergenic
1044925130 8:97202983-97203005 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1045644752 8:104287998-104288020 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1046216999 8:111161726-111161748 TAGGTCATGAATATCTTTTTTGG - Intergenic
1047856340 8:128916456-128916478 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1048135438 8:131742763-131742785 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1049868849 8:144957931-144957953 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1050140450 9:2511472-2511494 GAGGGCTGGAATCTAATTTTTGG - Intergenic
1050349938 9:4731652-4731674 GAGTCTTTGCATATAATTTTGGG - Intronic
1051052596 9:12950385-12950407 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1051178442 9:14384730-14384752 CAGGCCATGAATAGAATTTCAGG - Intronic
1051245835 9:15110063-15110085 TAGACATTGTATATAATTTCAGG + Intergenic
1051483384 9:17583064-17583086 TAGGACTTTAATATGAATTTTGG + Intronic
1051934161 9:22424011-22424033 CTGGCCATTAATATAATTTTAGG - Intergenic
1052720671 9:32168179-32168201 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1052724206 9:32209974-32209996 TAAGACTTGAACATTATTTTAGG + Intergenic
1053057995 9:35005526-35005548 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1053078486 9:35154878-35154900 GAGGGCCGGAATATAATTTTTGG + Intergenic
1053186696 9:36022388-36022410 TTGGCCTTGAATACATTTTTGGG + Intergenic
1054807519 9:69408425-69408447 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1054977195 9:71161533-71161555 TAAGCCTTGAAAATAATATAAGG + Intronic
1055008477 9:71536632-71536654 TGTGCCTTGTCTATAATTTTAGG - Intergenic
1055347751 9:75355453-75355475 GAGGGCTGGAATGTAATTTTTGG + Intergenic
1057780665 9:98047429-98047451 TAGAGCTTGAATATCTTTTTGGG - Intergenic
1057812611 9:98269483-98269505 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1058785955 9:108387066-108387088 AAGGCTTTGAATATGATTTGTGG - Intergenic
1059027928 9:110657159-110657181 TTGGGCTTGAATATAAATTTGGG - Intergenic
1059574592 9:115475424-115475446 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1060318502 9:122534260-122534282 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1203663941 Un_KI270754v1:8577-8599 TAGACCGTTAATATAATTGTTGG - Intergenic
1186464919 X:9777721-9777743 AAGGCCATGTACATAATTTTAGG - Intronic
1186491706 X:9978972-9978994 TTGGCCTTAAGTATGATTTTGGG - Intergenic
1188333053 X:28896261-28896283 GAGGGCTGGAATTTAATTTTTGG + Intronic
1188552621 X:31379547-31379569 GAGGGCTGGAATTTAATTTTTGG - Intronic
1188631319 X:32365117-32365139 GAGGCCTTGAAAACAGTTTTGGG - Exonic
1188794913 X:34451277-34451299 TATGCCCTGATTTTAATTTTAGG - Intergenic
1189696111 X:43664728-43664750 TATGCCTTGAGTAAAATTTGTGG + Intronic
1190939634 X:55027914-55027936 TAAGCCTTTAGTATAGTTTTTGG + Intronic
1191825524 X:65361756-65361778 GAGGGCTGGAATCTAATTTTTGG - Intergenic
1192706114 X:73529705-73529727 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1192914160 X:75635937-75635959 TAGGGCTGGAATCTAATTTTTGG + Intergenic
1193537071 X:82728926-82728948 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1193629441 X:83864225-83864247 TAGAACTTAAATATAAATTTGGG + Intronic
1193669121 X:84362169-84362191 GAGGCCATAAATATGATTTTAGG - Intronic
1193748586 X:85314246-85314268 TAGTGATTCAATATAATTTTTGG + Intronic
1194070414 X:89318005-89318027 TAGCCTTTTAATATAATTTGAGG + Intergenic
1194503010 X:94702463-94702485 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1195326892 X:103765446-103765468 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1195503931 X:105635311-105635333 TAGGCCAAGAACAGAATTTTAGG + Intronic
1196110734 X:111944517-111944539 TAAGACTTGAATATATCTTTTGG - Intronic
1196299983 X:114042049-114042071 GAGGACTGGAATTTAATTTTTGG - Intergenic
1196525507 X:116724623-116724645 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1197194854 X:123688973-123688995 GAGACACTGAATATAATTTTTGG + Intronic
1197367623 X:125583430-125583452 TAGGACTTGAACATATCTTTTGG - Intergenic
1197373418 X:125653004-125653026 TCGCCATTGAATATAATGTTAGG + Intergenic
1197793614 X:130279100-130279122 GAGGGCTGGAATCTAATTTTTGG - Intergenic
1198081418 X:133243591-133243613 TAGGCCCTGTATATAATGTTTGG + Intergenic
1198598419 X:138260860-138260882 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1198599428 X:138267953-138267975 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1198965892 X:142228591-142228613 GAGGGCTGGAATTTAATTTTTGG - Intergenic
1198972204 X:142294539-142294561 TAGGCCTTGCTTATTATATTAGG + Intergenic
1200724656 Y:6653647-6653669 TAGCCTTTTAATATAATTTGAGG + Intergenic
1201473531 Y:14358067-14358089 GAGGGCTGGAATTTAATTTTTGG + Intergenic
1202133256 Y:21633983-21634005 TAGGGCTTGCTTTTAATTTTAGG + Intergenic