ID: 1067747148

View in Genome Browser
Species Human (GRCh38)
Location 10:48944387-48944409
Sequence AAAACTCCACAGCTGGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067747138_1067747148 12 Left 1067747138 10:48944352-48944374 CCTGCGCCCCAGCAGGCAGGGAA 0: 1
1: 0
2: 2
3: 31
4: 287
Right 1067747148 10:48944387-48944409 AAAACTCCACAGCTGGACCAGGG No data
1067747143_1067747148 4 Left 1067747143 10:48944360-48944382 CCAGCAGGCAGGGAAAGGATGGG 0: 1
1: 0
2: 4
3: 45
4: 410
Right 1067747148 10:48944387-48944409 AAAACTCCACAGCTGGACCAGGG No data
1067747132_1067747148 20 Left 1067747132 10:48944344-48944366 CCTGCACCCCTGCGCCCCAGCAG 0: 1
1: 0
2: 8
3: 70
4: 568
Right 1067747148 10:48944387-48944409 AAAACTCCACAGCTGGACCAGGG No data
1067747140_1067747148 6 Left 1067747140 10:48944358-48944380 CCCCAGCAGGCAGGGAAAGGATG 0: 1
1: 1
2: 8
3: 48
4: 366
Right 1067747148 10:48944387-48944409 AAAACTCCACAGCTGGACCAGGG No data
1067747135_1067747148 14 Left 1067747135 10:48944350-48944372 CCCCTGCGCCCCAGCAGGCAGGG 0: 1
1: 0
2: 2
3: 43
4: 600
Right 1067747148 10:48944387-48944409 AAAACTCCACAGCTGGACCAGGG No data
1067747137_1067747148 13 Left 1067747137 10:48944351-48944373 CCCTGCGCCCCAGCAGGCAGGGA 0: 1
1: 0
2: 1
3: 31
4: 328
Right 1067747148 10:48944387-48944409 AAAACTCCACAGCTGGACCAGGG No data
1067747141_1067747148 5 Left 1067747141 10:48944359-48944381 CCCAGCAGGCAGGGAAAGGATGG 0: 1
1: 0
2: 4
3: 33
4: 357
Right 1067747148 10:48944387-48944409 AAAACTCCACAGCTGGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067747148 Original CRISPR AAAACTCCACAGCTGGACCA GGG Intronic
No off target data available for this crispr