ID: 1067748197

View in Genome Browser
Species Human (GRCh38)
Location 10:48952348-48952370
Sequence CACTGTAATCAGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067748197_1067748205 -1 Left 1067748197 10:48952348-48952370 CCAGCCTCCCTCTGATTACAGTG 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1067748205 10:48952370-48952392 GAAAGGGCATGGGATCTGTAAGG No data
1067748197_1067748207 19 Left 1067748197 10:48952348-48952370 CCAGCCTCCCTCTGATTACAGTG 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1067748207 10:48952390-48952412 AGGGCCCAAAGTGTGACTTGAGG No data
1067748197_1067748206 0 Left 1067748197 10:48952348-48952370 CCAGCCTCCCTCTGATTACAGTG 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1067748206 10:48952371-48952393 AAAGGGCATGGGATCTGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067748197 Original CRISPR CACTGTAATCAGAGGGAGGC TGG (reversed) Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900967863 1:5971840-5971862 CACTGGAGACAGAGGGAGACGGG + Intronic
902689938 1:18104805-18104827 CACCATGAACAGAGGGAGGCTGG + Intergenic
902759457 1:18571735-18571757 CACTGTGACCAGAGGTGGGCTGG - Intergenic
903122822 1:21227389-21227411 CCCTGAAGCCAGAGGGAGGCTGG + Intronic
903262597 1:22139486-22139508 CGCTGCACTCAGAGGCAGGCCGG - Intronic
903763138 1:25713180-25713202 CACTGGACTGAGAGGCAGGCAGG - Intronic
904046185 1:27610035-27610057 GCCTGTAATCTCAGGGAGGCAGG + Intergenic
904779814 1:32937413-32937435 CACTCAAATGAGATGGAGGCTGG + Intronic
905772616 1:40648151-40648173 CCCATTAATCAGAGGGAGGTTGG - Intronic
905854231 1:41297007-41297029 AATTGTAATCAGAGGGTGGTTGG + Intergenic
906808557 1:48803365-48803387 CACTGTAGGCAGAGGGAGATTGG - Intronic
909635200 1:77809944-77809966 CACTGTAAGAAGAGGTATGCAGG + Intronic
910067900 1:83175330-83175352 CAAAGCAATAAGAGGGAGGCAGG + Intergenic
910212651 1:84809403-84809425 CACTGGAATCACATGCAGGCAGG - Intergenic
911263940 1:95720844-95720866 CACTGTTATGAGAGGAAGTCGGG - Intergenic
915436679 1:155911703-155911725 CAATGTAATGAGAGGAAGGGAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
917736809 1:177928985-177929007 CACTGGAGTGAGAGGGAGGAGGG - Intronic
918099918 1:181364466-181364488 CACTGTGATCAGAGGTGGGATGG + Intergenic
920198606 1:204245502-204245524 CACTGTGTTCAGAGCCAGGCAGG - Intronic
922121052 1:222668974-222668996 CACTGTAAGAAGAGGTATGCAGG + Exonic
922974389 1:229771471-229771493 GAATATCATCAGAGGGAGGCAGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
924636634 1:245793889-245793911 CACATTAATCAGAGGAAAGCTGG - Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1065741244 10:28799060-28799082 GCCTGTAATCATAGGGAGGTGGG + Intergenic
1065970144 10:30799552-30799574 CACTGCAGGCACAGGGAGGCAGG - Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1067895110 10:50170495-50170517 CACTGTCTTCACAGGGTGGCAGG - Intergenic
1069646921 10:70006802-70006824 CCCTGTCCTTAGAGGGAGGCAGG - Intergenic
1071704449 10:87982183-87982205 CTCTAAAATGAGAGGGAGGCAGG - Intergenic
1074304270 10:112262323-112262345 AAGTGTGATCAGATGGAGGCTGG - Intergenic
1075981810 10:126746797-126746819 GACTGGAATCAGAGGGAGGGAGG + Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083838857 11:65291467-65291489 CACCTTCATCTGAGGGAGGCAGG - Intronic
1085202419 11:74709670-74709692 CACTGAAAAGATAGGGAGGCAGG + Intronic
1085398240 11:76218549-76218571 CACTGGCTTGAGAGGGAGGCTGG + Intergenic
1089814352 11:121159014-121159036 CACTGTGAGCACAGAGAGGCAGG + Intronic
1089974880 11:122723811-122723833 CATTGTAATAGGAAGGAGGCAGG + Intronic
1090744345 11:129694503-129694525 AACTGTAGTCAGAGGGAGAGAGG + Intergenic
1092028484 12:5263220-5263242 CACTGCAAGCAGAAGCAGGCAGG + Intergenic
1093140615 12:15506564-15506586 CACCTTATTCAGAGGGTGGCAGG + Intronic
1093232241 12:16560404-16560426 CTTTGTAATCAGAGGTAAGCAGG - Exonic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1095862226 12:46930172-46930194 CTCTGTAACTTGAGGGAGGCAGG + Intergenic
1096158525 12:49356850-49356872 CACTGTAGTCCGAGTGAGGAGGG + Intronic
1097446001 12:59671631-59671653 CACTGTAGTCAAAGGGACACAGG - Intronic
1103044198 12:117721812-117721834 CCCTTTAAGCAGAGGGAGGTGGG + Intronic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1104932085 12:132345204-132345226 CACTGCTATCGGAGGGCGGCAGG + Intergenic
1105874620 13:24541137-24541159 CCCTGAATTCAGAGGGAGGCTGG + Intergenic
1106366898 13:29090438-29090460 CACTGTAGTCAGGGGGCTGCAGG + Intronic
1106744554 13:32686149-32686171 CACTGTAATCAAAAGGAAGCTGG - Intronic
1112470694 13:99685997-99686019 CACTCTTATCACAGGGACGCAGG - Intronic
1112501188 13:99944678-99944700 CTCTGTAAGCAGGTGGAGGCAGG - Intergenic
1113781638 13:112980777-112980799 CAGTGGACTCGGAGGGAGGCTGG - Intronic
1114370130 14:22077342-22077364 CACTGGAATCTGAGGGAAGAAGG + Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1117732447 14:58736940-58736962 CAAGGTAATCAGAGAGAGACCGG + Intergenic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118250154 14:64151900-64151922 CACTCTACTCAGAGGAAGGACGG - Intronic
1120967803 14:90183003-90183025 CACTCTCATCAGAGGGATGAGGG - Intronic
1121452063 14:94014986-94015008 CACTGAATTCAGAGGGAGGTTGG + Intergenic
1127486222 15:59420311-59420333 CACTGTAACCATATGTAGGCGGG + Intronic
1127560108 15:60127785-60127807 CACTGTAAGCCGAGACAGGCTGG + Intergenic
1128333969 15:66774319-66774341 GACTGCAGTCTGAGGGAGGCGGG - Intronic
1128552995 15:68610169-68610191 CACTGGAACCAGAGGGCTGCAGG - Intronic
1129125645 15:73438651-73438673 CACTGATAGCAGAGGGAGACAGG + Intergenic
1129288648 15:74546197-74546219 CAAAGCAATCAGTGGGAGGCGGG - Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129919414 15:79307319-79307341 CTCTGTGATGAGAGGGAGGCTGG + Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131778268 15:95825987-95826009 CACTCTCATCAGAGGAAGGGAGG + Intergenic
1134869358 16:17637913-17637935 CACTGAAATGAAAGGGAGGAAGG + Intergenic
1137832462 16:51557144-51557166 AACTGAAATCAGAGCCAGGCGGG - Intergenic
1139346575 16:66307634-66307656 CACAGGATTCAGAGGGAGTCAGG + Intergenic
1139471249 16:67179261-67179283 CTCTGTAAGCAGAGGGCGGGAGG + Intronic
1140745698 16:77978313-77978335 ATCTGTAAACACAGGGAGGCAGG + Exonic
1141767759 16:86070101-86070123 CACCGAAGCCAGAGGGAGGCAGG + Intergenic
1142549667 17:731164-731186 CCGTGAAATGAGAGGGAGGCTGG - Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1150664945 17:67125636-67125658 CAATTTAATCAGAGTGTGGCAGG + Intronic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151967058 17:77436986-77437008 CACTGTAAACCGAGGGAGTGAGG - Intronic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1154095744 18:11413588-11413610 CACTGCACTCACAGGGAGACAGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1155899676 18:31373411-31373433 CACTGTAGTCATCGGGAGGCAGG + Intergenic
1159870982 18:73759533-73759555 CCCTGGAATCCGAGGGAGGCTGG - Intergenic
1161237499 19:3205135-3205157 CACAGTGCCCAGAGGGAGGCGGG - Intronic
1164924868 19:32122722-32122744 CACTGGAAGCAGAGTGAGCCTGG - Intergenic
1166296614 19:41893109-41893131 GACTGTCATAAGAGGGAGGGAGG - Intronic
1166732510 19:45067150-45067172 CTCTGTAGCCGGAGGGAGGCCGG + Intronic
1168554387 19:57325970-57325992 AACTGTACTCTGAGGTAGGCAGG - Intronic
926416731 2:12656830-12656852 TACTGGAATCAGTGAGAGGCAGG + Intergenic
927371022 2:22355428-22355450 CACTGAACTTAGAAGGAGGCTGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927712148 2:25332644-25332666 GCCTGGAATCAGAGGGAGCCAGG - Intronic
931508147 2:62955697-62955719 CATTGTAATCATGGGGAGGAGGG + Intronic
931692558 2:64847725-64847747 TAGTGCAATCAGAGGGAGGAGGG + Intergenic
932345927 2:70995019-70995041 CGCTGCAGCCAGAGGGAGGCGGG + Exonic
932512168 2:72303831-72303853 CACTTCAATCAGAGGCAGCCTGG - Intronic
934972638 2:98775350-98775372 CACTGTGTTCTCAGGGAGGCAGG + Intergenic
938578985 2:132629143-132629165 CACTGGACTCAGATGGAGACTGG + Intronic
944878309 2:203985416-203985438 CACAGTAGACACAGGGAGGCAGG - Intergenic
944934545 2:204554211-204554233 TACTGTAAGCAGAGAGAGACAGG - Intronic
947498959 2:230658633-230658655 CACTGTACCCAGTGGGGGGCTGG - Intergenic
1169482222 20:5994637-5994659 CACTGTAATCACAGTGACTCAGG + Exonic
1169895229 20:10498264-10498286 AGCTGTAAACACAGGGAGGCAGG - Intronic
1170907517 20:20529072-20529094 CACGGAAACTAGAGGGAGGCAGG + Intronic
1172977730 20:38919267-38919289 CGCTGTGTTCAGAGGGAGCCAGG + Exonic
1173044156 20:39493499-39493521 CTCTGTGGTCAGAGGTAGGCAGG - Intergenic
1173441151 20:43077414-43077436 CACTGTCAACATAGGGAGCCTGG + Intronic
1174049950 20:47760550-47760572 CACTGTTTTCAGAGGCAGGTGGG - Intronic
1175042682 20:56070306-56070328 CACAGTAATAATAGGCAGGCAGG + Intergenic
1175334246 20:58184830-58184852 CAATGGAAGCAGAGAGAGGCTGG + Intergenic
1175680013 20:60979340-60979362 AGCTGCAATCAGAAGGAGGCAGG - Intergenic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1181694276 22:24585174-24585196 CACTGTACCCTGTGGGAGGCAGG + Intronic
949808751 3:7983560-7983582 CAATGAAAACAGAGAGAGGCTGG + Intergenic
950464327 3:13144380-13144402 CACCCACATCAGAGGGAGGCAGG + Intergenic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953616806 3:44497964-44497986 CAGTGTAATGGGAGGGAGACGGG + Intergenic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954294857 3:49668605-49668627 CACAGTAAACAGAGGCGGGCTGG - Exonic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
955872127 3:63450498-63450520 CATTTTAAACAGAGGAAGGCTGG + Intronic
960713048 3:120550151-120550173 GGGTGTAATCAGAGGAAGGCAGG + Intergenic
960925801 3:122794190-122794212 CACTAAAATCAGAAGGAGTCAGG - Intergenic
961001557 3:123377506-123377528 CACAGCACTCAGAGGGAGGGAGG - Intronic
961838187 3:129682512-129682534 CACTGTAGGCTCAGGGAGGCAGG - Intronic
962321273 3:134392640-134392662 CACTGTGCTCAGAGTGAGGCTGG - Intergenic
963715938 3:148804033-148804055 TACTGAATTCAGAGGGTGGCTGG + Intronic
964746308 3:160015988-160016010 CACTGTAATCTGCAGTAGGCAGG - Intergenic
965995268 3:174874069-174874091 CACTGTAATCAGTGGGCTGGAGG - Intronic
966473935 3:180322888-180322910 CATTGTAAACAGGCGGAGGCTGG + Intergenic
968939262 4:3629637-3629659 CTCTGGACTCAGAGGGAGCCAGG - Intergenic
969669782 4:8583308-8583330 CACCGTGGTTAGAGGGAGGCAGG + Intronic
969695206 4:8730329-8730351 CTCTGTGATCAGAGAGAGGCCGG + Intergenic
970042947 4:11817262-11817284 CTCTGTCATCACAGGGAAGCTGG + Intergenic
970067550 4:12116216-12116238 CACTGTGATCTCAGGGAAGCAGG + Intergenic
971866597 4:32180106-32180128 CAATTCAAACAGAGGGAGGCAGG + Intergenic
973792864 4:54394633-54394655 CACTGTTCAGAGAGGGAGGCAGG - Intergenic
977570142 4:98620711-98620733 CACTGCAATCAGAGGGAGTGTGG + Intronic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
985850515 5:2385253-2385275 CACTGAACTCAGAGGGATGGAGG - Intergenic
987435939 5:17894286-17894308 GGCTGCAGTCAGAGGGAGGCTGG - Intergenic
992092274 5:73327789-73327811 CACTGTAATCAGAGATTGCCTGG + Intergenic
992429185 5:76691124-76691146 CACTGTAGTGGGAGGGAGGTGGG + Intronic
992800653 5:80292769-80292791 CACTGACACCAGAGTGAGGCTGG - Intergenic
992965614 5:81997000-81997022 CACTGGTGTCAGAGGGATGCTGG - Intronic
996575939 5:124976490-124976512 TCCTGCAAGCAGAGGGAGGCTGG + Intergenic
996722860 5:126647198-126647220 CACTGTCATCAGAGGGTAACTGG - Intergenic
999029154 5:148270785-148270807 GATTCTTATCAGAGGGAGGCAGG + Intronic
999256447 5:150212264-150212286 CACTGTAATCAGGGCCAGGCTGG - Intronic
999837449 5:155389811-155389833 CACTGTGATAAGTGGGAGGCTGG - Intergenic
1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG + Intergenic
1000537309 5:162494454-162494476 CACTGTAAATGGAGGGAGGGAGG + Intergenic
1000945045 5:167412125-167412147 CACTGGAACCAGAGGGATCCTGG - Intronic
1001454265 5:171848648-171848670 CACTGTGGTCAGAGGCTGGCGGG + Intergenic
1001746590 5:174097105-174097127 CACTGTGATTAGATGGAGGGAGG + Intronic
1002213099 5:177609900-177609922 CACAGTGATCAGAGAGAGGCTGG + Exonic
1002529203 5:179833835-179833857 CGCTGAAATCAGAGGAGGGCAGG - Intronic
1002595115 5:180317195-180317217 CACTACCATCAGAGGGAAGCAGG + Intronic
1003543967 6:7042749-7042771 CACTCTAAGGAGAGGGAGTCAGG - Intergenic
1005931771 6:30489974-30489996 TACTACAATCAGAGCGAGGCCGG + Exonic
1006109364 6:31735381-31735403 CGCTGCAATCAGAGGGGGGCTGG + Intronic
1007736114 6:43983307-43983329 CACTGTGAGCAGAGGGACTCAGG - Intergenic
1010291053 6:74138394-74138416 CACTGTGATCATAGAGAAGCAGG - Intergenic
1011471664 6:87714025-87714047 AAATATAATCAGAGGCAGGCCGG - Intergenic
1011629836 6:89312594-89312616 GACTGTAATCAGAAGGGGTCTGG + Intronic
1012490730 6:99780181-99780203 CACTGGAAGCAGAGGCAGGGTGG + Intergenic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1013266227 6:108501744-108501766 CACTTAAATCTAAGGGAGGCTGG + Intronic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1014690044 6:124552348-124552370 CACTGAAATCTGAATGAGGCAGG + Intronic
1014729755 6:125019073-125019095 CTCTGTGATCAGAGGCAAGCGGG - Intronic
1016932254 6:149422910-149422932 TTCTGAAATGAGAGGGAGGCAGG + Intergenic
1017679251 6:156846857-156846879 GACAGGAATCAGAGGGTGGCGGG - Intronic
1018720043 6:166565484-166565506 CACTGTAGGCAGAGGCAGCCGGG - Intronic
1019182841 6:170202630-170202652 CACTGTAAGCTCAGGGAGGGCGG - Intergenic
1019521952 7:1464845-1464867 CACAGCAATCAGAGGCAGGCTGG - Intergenic
1020975771 7:15004119-15004141 CAATTTTATAAGAGGGAGGCAGG - Intergenic
1023150527 7:37197483-37197505 CACTGAATTCAGAGGTAGGAAGG + Intronic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1027418074 7:77993449-77993471 CTCTGTAAGCAGAGGTATGCTGG - Intergenic
1031681958 7:124686407-124686429 GACTCTTATAAGAGGGAGGCAGG + Intergenic
1032086158 7:128884942-128884964 CCCTGGGATCAGGGGGAGGCTGG - Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1034272525 7:149810190-149810212 CACTCTAGTCAGAGGGTGGTAGG + Intergenic
1034413544 7:150953612-150953634 CACAGTCATCAGACAGAGGCAGG + Intronic
1037646241 8:20795378-20795400 CACTGTATTTCAAGGGAGGCTGG - Intergenic
1038800566 8:30744979-30745001 CACTGCAATCAGAGGAGGGTAGG + Intronic
1044251666 8:90009757-90009779 GACTCAAATCAGAGGCAGGCAGG + Intronic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1044531320 8:93310683-93310705 TGCTCTAATAAGAGGGAGGCAGG + Intergenic
1047919571 8:129620253-129620275 TACTGTAATGAGAGGGAGGATGG - Intergenic
1048327807 8:133452432-133452454 CACAGGCATCAGAGGGAGGGAGG + Intergenic
1049020957 8:139957428-139957450 CTCTGGAGTCAGAGAGAGGCAGG + Intronic
1049537852 8:143190219-143190241 CGCTGTAAGAGGAGGGAGGCGGG - Intergenic
1049748096 8:144271449-144271471 CATTGTAATCGGAGAGGGGCTGG - Intronic
1053361279 9:37488390-37488412 CACTGTACAGAGGGGGAGGCTGG - Intronic
1054451492 9:65405684-65405706 CTCTGGACTCAGAGGGAGCCAGG + Intergenic
1057040231 9:91842691-91842713 CTCTGGAATCAGAGGGCAGCAGG + Intronic
1058926284 9:109667155-109667177 CTCTGGAATCAGAGGGAGAGTGG + Intronic
1061805856 9:133137546-133137568 CACTTTAATGGGAGGGAGCCAGG - Intronic
1190181618 X:48197325-48197347 AACTGTAATCAGAGGTTGGAGGG - Intronic
1190635194 X:52426193-52426215 CCCTGCAAACTGAGGGAGGCTGG - Intergenic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1192170359 X:68851057-68851079 CCCTGTGATCAGAGGGACTCTGG + Intergenic
1192594862 X:72395682-72395704 CACTGTAATCAAAGGCAGTCTGG + Intronic
1193251164 X:79291988-79292010 CACTGTCACAAGAGTGAGGCTGG + Intergenic
1199506767 X:148571298-148571320 CACAGTAATCATAGGCAGGAGGG - Intronic
1200039316 X:153354260-153354282 TCCTGTAATGAGAGGTAGGCTGG - Intronic
1200703520 Y:6422196-6422218 CACCGTTATCAGAGGGCTGCAGG - Intergenic
1201030591 Y:9742511-9742533 CACCGTTATCAGAGGGCTGCAGG + Intergenic