ID: 1067749348

View in Genome Browser
Species Human (GRCh38)
Location 10:48959888-48959910
Sequence CTGGTCACTGGCCCTCCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 165}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067749348_1067749355 18 Left 1067749348 10:48959888-48959910 CCAAGTGGAGGGCCAGTGACCAG 0: 1
1: 0
2: 5
3: 22
4: 165
Right 1067749355 10:48959929-48959951 TGGAAAACCCAGAGAAGGGATGG 0: 1
1: 0
2: 3
3: 49
4: 587
1067749348_1067749352 -2 Left 1067749348 10:48959888-48959910 CCAAGTGGAGGGCCAGTGACCAG 0: 1
1: 0
2: 5
3: 22
4: 165
Right 1067749352 10:48959909-48959931 AGCACTGTGAGGCTCATGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 159
1067749348_1067749356 19 Left 1067749348 10:48959888-48959910 CCAAGTGGAGGGCCAGTGACCAG 0: 1
1: 0
2: 5
3: 22
4: 165
Right 1067749356 10:48959930-48959952 GGAAAACCCAGAGAAGGGATGGG 0: 1
1: 0
2: 1
3: 33
4: 495
1067749348_1067749354 14 Left 1067749348 10:48959888-48959910 CCAAGTGGAGGGCCAGTGACCAG 0: 1
1: 0
2: 5
3: 22
4: 165
Right 1067749354 10:48959925-48959947 TGTCTGGAAAACCCAGAGAAGGG 0: 1
1: 1
2: 3
3: 43
4: 368
1067749348_1067749357 20 Left 1067749348 10:48959888-48959910 CCAAGTGGAGGGCCAGTGACCAG 0: 1
1: 0
2: 5
3: 22
4: 165
Right 1067749357 10:48959931-48959953 GAAAACCCAGAGAAGGGATGGGG 0: 1
1: 0
2: 2
3: 51
4: 481
1067749348_1067749353 13 Left 1067749348 10:48959888-48959910 CCAAGTGGAGGGCCAGTGACCAG 0: 1
1: 0
2: 5
3: 22
4: 165
Right 1067749353 10:48959924-48959946 ATGTCTGGAAAACCCAGAGAAGG 0: 1
1: 0
2: 3
3: 28
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067749348 Original CRISPR CTGGTCACTGGCCCTCCACT TGG (reversed) Intronic
900090812 1:919670-919692 CTGGGCCCTGGCTCTGCACTCGG + Intergenic
901812635 1:11776570-11776592 CTGGACACTGGCCCTCTGCTGGG + Exonic
903323992 1:22559250-22559272 CTTGGCACTGGCACTCCACCGGG - Intergenic
903794860 1:25921045-25921067 CTCAACACTGGCGCTCCACTGGG - Intergenic
905313342 1:37065703-37065725 CTGCCCACTGGCCGTCCACCTGG + Intergenic
906148780 1:43575683-43575705 CAGGTCACTGGCTCTGCTCTGGG - Intronic
907284361 1:53370584-53370606 GTGGTGACTGGGCCTCCCCTGGG + Intergenic
907326907 1:53644197-53644219 CGGGTCACCCTCCCTCCACTTGG + Intronic
913217348 1:116631526-116631548 CAGATCACTGGACCTCCACTGGG + Intronic
914194437 1:145438254-145438276 CTGGTCACTGATTCTCTACTTGG + Intergenic
914475766 1:148021136-148021158 CTGGTCACTGATTCTCTACTTGG + Intergenic
914747590 1:150511302-150511324 CCGTTCACTGGCCCTACCCTGGG + Intronic
915447142 1:155980205-155980227 CTTGTCTCTGGGCCTCCAGTGGG - Intronic
917721547 1:177791121-177791143 CTCATTACTGACCCTCCACTGGG - Intergenic
920174756 1:204093583-204093605 CTTGTCACTGGCTGTCCCCTTGG + Intronic
923296657 1:232601066-232601088 CTGGTCCCTTGCTCTCCTCTAGG - Intergenic
1062777155 10:161228-161250 CTGCTCACTGGCAATCCACCTGG - Intronic
1064284628 10:13981851-13981873 CAGGTCACTGGATCCCCACTGGG - Intronic
1067749348 10:48959888-48959910 CTGGTCACTGGCCCTCCACTTGG - Intronic
1067794733 10:49312551-49312573 CTGGACGCTGGCCCTCCAGAAGG + Intronic
1069793581 10:71038963-71038985 CTGGTCAGTTGCCTTCCCCTGGG - Intergenic
1070865757 10:79707230-79707252 ATGGTCTCGGGCCCTGCACTGGG + Intronic
1070879550 10:79845361-79845383 ATGGTCTCGGGCCCTGCACTGGG + Intronic
1073460023 10:103660951-103660973 CTGGCCAATGGCCGTCCACTGGG - Intronic
1075551535 10:123396111-123396133 CTGGTCACTGCTCCTTCACCTGG - Intergenic
1076264524 10:129099300-129099322 CTGTACACTAGCCCTCCTCTGGG - Intergenic
1076406996 10:130219060-130219082 CTGCTCACTGGCCCACCCCATGG + Intergenic
1076530513 10:131141526-131141548 CTGGTGACTGGCCAAGCACTGGG - Intronic
1077108726 11:852951-852973 CTGGTCACTGGCTGCCCACTGGG - Intronic
1078312453 11:10258662-10258684 ATGGTCACTGGCCCTCAGCGTGG - Intronic
1079032513 11:16996341-16996363 CTGGTCAAAGGCCCTCAACATGG + Intronic
1079364439 11:19797053-19797075 GGGGTCACTGGCCCCCCACACGG + Intronic
1080774815 11:35375718-35375740 CAGGTCACTGGGCCTGGACTGGG + Intronic
1086402759 11:86474041-86474063 ATGGTCACCGGAGCTCCACTTGG + Intronic
1088528338 11:110780780-110780802 CTGTTCACTGGCCCTCTACTTGG + Intergenic
1089132611 11:116224322-116224344 GGGGTCACTGACCCTACACTGGG + Intergenic
1089778715 11:120857951-120857973 CTGGTCTCTGCCCCACCACTTGG + Intronic
1091640653 12:2234571-2234593 CTGGCCCCTGGCCCTACACCAGG - Intronic
1102207687 12:111101488-111101510 CGGCTCACTGTCCCTTCACTGGG + Intronic
1103415186 12:120738496-120738518 CTGGTCAGTGGCCCGCCAGCCGG - Intronic
1104019924 12:124985262-124985284 CTGGTCACTTTCCCACCTCTGGG - Intronic
1104558286 12:129821822-129821844 CTGGTCACTGGACCACCCCTGGG + Intronic
1104633551 12:130424415-130424437 CTGGTCACTGTCCCTGCAGGAGG - Intronic
1104646099 12:130498504-130498526 CTGGTCACTTGCACATCACTGGG - Intronic
1105759787 13:23503312-23503334 TTAGTCTCAGGCCCTCCACTGGG + Intergenic
1114619787 14:24088456-24088478 TTGGCCACTGGCCCTCAGCTGGG - Intronic
1117707921 14:58492156-58492178 CTAATCACTTGCCCTTCACTAGG - Exonic
1118386119 14:65256971-65256993 CTTGTCCCTGGCCCTCCACTAGG + Intergenic
1122299287 14:100722922-100722944 CTGGGCACTGGTCCTCGCCTTGG + Intergenic
1122863684 14:104593950-104593972 CTGGCCACTGCCCCTCCTCGGGG - Intronic
1125767622 15:42145912-42145934 CTGGTGACTTTCCCTTCACTCGG - Intronic
1131425764 15:92344358-92344380 CTGGCCAGGGGCCCTGCACTGGG - Intergenic
1133058324 16:3158545-3158567 CTGGTCACCGGCCCTCCTCTCGG + Intergenic
1133080623 16:3316417-3316439 TTAGCCACTGGCCCTCAACTAGG - Intronic
1133312984 16:4862931-4862953 CTGGTCACCAGCTCCCCACTGGG - Intronic
1134539688 16:15055045-15055067 CTGATCACTGTCCCTGCCCTCGG - Intronic
1134677258 16:16099381-16099403 CTGGCCACTGGAATTCCACTAGG - Intronic
1141013444 16:80425142-80425164 CTGGTCTCTAGCCCTAGACTTGG + Intergenic
1141131888 16:81443194-81443216 CTGGTCACAGGCCAGGCACTAGG - Intergenic
1141843484 16:86590537-86590559 CTGATTACTTGGCCTCCACTTGG + Intergenic
1141988442 16:87594948-87594970 CTGCTCAGTGGCCTTCCACAGGG + Intergenic
1142172466 16:88630060-88630082 CTGGGCAGTGGCCCCCCCCTCGG + Intronic
1142230072 16:88895935-88895957 CTGGTCCCTGGAGCCCCACTTGG - Intronic
1143243610 17:5464919-5464941 CTGCACAGTGGCCCTCCTCTGGG + Intronic
1144713989 17:17421670-17421692 CTGCTCAGTGACCCTCCATTGGG - Intergenic
1147388028 17:40093079-40093101 CGGGTCACTGGGCGTCCACCCGG + Exonic
1147765678 17:42833965-42833987 CTGGACACTGCCCCTGCCCTTGG + Intronic
1149588667 17:57811187-57811209 CGGGTCCCGGGCCCTCCACGGGG + Intergenic
1151191333 17:72400188-72400210 CTGATCACCGGCCCTGCCCTTGG - Intergenic
1151468241 17:74301553-74301575 CTGGTCACCTGCCTTCCTCTGGG + Intronic
1152234714 17:79132700-79132722 CTGCTCACTGGCCCTCCCCTGGG + Intronic
1152514661 17:80816326-80816348 CTGCTCTCTGGTCCTGCACTGGG - Intronic
1152650507 17:81490382-81490404 CTGGTCAGGGGCCCCCCAGTTGG + Intergenic
1158403427 18:57140952-57140974 CTGGCCAATGGCCCTGCAGTTGG + Intergenic
1158604560 18:58883844-58883866 CAAGTCAGTGGCTCTCCACTGGG - Intronic
1160410719 18:78673772-78673794 ATGGGCACTGGCACTCCTCTTGG + Intergenic
1161243133 19:3234066-3234088 CTTGTCCCTGACCCTCCACTAGG + Intronic
1162042224 19:7977876-7977898 CTGGCCACTGGGTCTCCTCTAGG + Intronic
1164472875 19:28550539-28550561 CGGGTCCCTGGCCCTCTCCTCGG + Intergenic
1164472893 19:28550606-28550628 CGGGTCCCTGGCCCTCTCCTCGG + Intergenic
1164831078 19:31321316-31321338 CTGCTCACTGGCCCGCCAATCGG + Intronic
1167522106 19:49961131-49961153 ATGGTCACTGCCCCTCCACCAGG - Exonic
1167523276 19:49969594-49969616 ATGGTCACTGCCCCTCCACCAGG + Intergenic
925392249 2:3503883-3503905 CTGTTCACTCGGCATCCACTGGG - Intronic
926735235 2:16068739-16068761 CTGGACCCTGGGCCCCCACTGGG + Intergenic
928090171 2:28369003-28369025 GTGGTCACTGGCCCTTCCCAGGG - Intergenic
935012520 2:99149097-99149119 CGGCTCACTGGACCTCCACCCGG - Intronic
936517627 2:113192446-113192468 GTGGTCTCTGGCCTTCCTCTGGG - Exonic
937924562 2:127157867-127157889 CAGCCCCCTGGCCCTCCACTGGG - Intergenic
940722232 2:157294564-157294586 CAGGTCTCAGACCCTCCACTCGG - Intronic
946721719 2:222615850-222615872 TTGGGCACTTGCCCTCCAATGGG - Intronic
947679179 2:232014114-232014136 CTGGCCCCTGGCCTTCCACCTGG - Intronic
948332065 2:237177573-237177595 CTGGTCTCTTGCCACCCACTGGG - Intergenic
948981265 2:241496094-241496116 CTGGCCTCTGCCCCTCCACCTGG - Intronic
1168810519 20:701666-701688 CTTGTCACTGGTCCCCCACCTGG - Intergenic
1170707166 20:18754705-18754727 CAGGTTACTGGCCATCAACTGGG - Intronic
1172056600 20:32158556-32158578 CGGGTCACTCCCACTCCACTCGG + Intronic
1172632122 20:36385630-36385652 CTGGCCACTGACCCCCCACAAGG - Intronic
1174176935 20:48651239-48651261 CTGGTCCTTGTCCCACCACTAGG - Intronic
1174488027 20:50873367-50873389 CTGGTCACTGACCCTTGCCTGGG + Intronic
1175223974 20:57434072-57434094 TAGGGCACTGGCTCTCCACTGGG + Intergenic
1175964636 20:62654408-62654430 CTGCTCACTGGGCCTGCGCTGGG - Intronic
1178288130 21:31343271-31343293 CTGGTCACTGGGCTTCCATTTGG - Intronic
1178358404 21:31927793-31927815 CTGGACAATGGTCCTCCCCTGGG - Intronic
1178917788 21:36718630-36718652 CTGGGCACTGGGACTCCCCTTGG + Intronic
1180818655 22:18809609-18809631 CAGATCACTGGACCTCCACTGGG + Intergenic
1181204878 22:21244064-21244086 CAGATCACTGGACCTCCACTGGG + Intergenic
1181537927 22:23556317-23556339 CTGGGCCCTGGGCCTCCATTAGG + Intergenic
1181771704 22:25130682-25130704 TTGGTGTCTGGGCCTCCACTCGG + Intronic
1182089287 22:27583287-27583309 GTGGTGTCTGGCCCTCCAATGGG + Intergenic
1182504805 22:30774048-30774070 CATGACACTGGTCCTCCACTCGG - Intronic
1183726020 22:39590117-39590139 CCGGGCACTGCCCCTCCACACGG + Intronic
1184104952 22:42362155-42362177 CTGCCCACTGGCCATCCACGTGG + Intergenic
1184858017 22:47157024-47157046 CTGGCCACTGCCCCTCCATAGGG - Intronic
1203222047 22_KI270731v1_random:51351-51373 CAGATCACTGGACCTCCACTGGG - Intergenic
1203268784 22_KI270734v1_random:35462-35484 CAGATCACTGGACCTCCACTGGG + Intergenic
950046232 3:9950036-9950058 CTGGGGACTGGCCCTGCCCTGGG - Exonic
952047548 3:29341661-29341683 CTTGTCCCTAGACCTCCACTTGG + Intronic
953631044 3:44617933-44617955 CTTGTCACTTGCCCTCCAGTTGG - Intronic
954412154 3:50375528-50375550 CTGGCCACTGGTGCCCCACTGGG + Intronic
954878206 3:53817166-53817188 CAGGTAACTGGGGCTCCACTGGG - Exonic
956148893 3:66220910-66220932 CTCCTCTCTGGCCCTCCCCTAGG + Exonic
960225829 3:115167450-115167472 ATGGTCACTGGACCTGCACTGGG - Intergenic
961155969 3:124680100-124680122 CTGCTCACGGGCCCAGCACTGGG - Intronic
961378552 3:126482649-126482671 CCTGTCTCTGGCCCTCCTCTGGG + Intronic
961821900 3:129579433-129579455 CTGGTCTCTGCCCCTCCCCCAGG - Intronic
961829454 3:129615986-129616008 CTGGGCACAGGGGCTCCACTGGG + Intergenic
962598896 3:136975861-136975883 CTGATCATTGGGCCTCCACATGG + Intronic
965443396 3:168744963-168744985 CTTGTAATGGGCCCTCCACTTGG - Intergenic
966973343 3:185065302-185065324 CAGGTCACATGCCCACCACTTGG + Intergenic
968939514 4:3630770-3630792 CTGGTCACCCGTCCTGCACTAGG + Intergenic
969694292 4:8725957-8725979 AGGGTCACTGTCCCTCCACACGG - Intergenic
971099716 4:23451764-23451786 CTGCTCCCTGTCCCACCACTGGG + Intergenic
971676149 4:29631808-29631830 CTGGTCAGTGGTCATCCACATGG + Intergenic
972459371 4:39286501-39286523 CTGTTCTCTGGCCGGCCACTGGG - Intergenic
975238820 4:72032351-72032373 TTGGTCACTGGCCCAACACTGGG + Intronic
978478507 4:109160724-109160746 CAGGTCACTGGCCATCCCTTGGG - Intronic
979863575 4:125724368-125724390 CTGGTCTCTGGTCCTCACCTTGG - Intergenic
982713050 4:158777734-158777756 CTGGTAACTGGCCCTGCAGTGGG + Intronic
983099234 4:163604721-163604743 CTGCTCCCTGGCTCTCTACTAGG + Intronic
984140872 4:176002340-176002362 CTGGTCACTCGCTCTCCTCTGGG - Intronic
985575982 5:673700-673722 CTGGTCCCCGGCCCCACACTGGG + Intronic
987166424 5:15202922-15202944 CTGGTCACTGCCTGTTCACTGGG + Intergenic
991012473 5:61898595-61898617 CTGGGCACTGGGCATACACTGGG + Intergenic
995122084 5:108547040-108547062 CTGGCCACTTGCCCTCATCTTGG + Intergenic
996478854 5:123950385-123950407 CTGCCCACTGGGCCTACACTGGG + Intergenic
998639912 5:143997637-143997659 TTGGTCATCTGCCCTCCACTGGG - Intergenic
999325286 5:150639932-150639954 CACGTGACTGGCCCTGCACTGGG + Intronic
1004070097 6:12289856-12289878 CTCGTCACTGCCCCACTACTGGG - Intergenic
1006334169 6:33411726-33411748 CTAGTGACTGGCTCTCCTCTCGG - Intronic
1006510365 6:34518060-34518082 CAGGACACTGGGCCTGCACTGGG + Intronic
1007165161 6:39823964-39823986 CTGGTTACTGTCCCTCAGCTGGG + Intronic
1007718743 6:43872713-43872735 CTCCTGGCTGGCCCTCCACTAGG - Intergenic
1010891114 6:81312203-81312225 CTGGTCACAGACCCTGCCCTGGG + Intergenic
1017210668 6:151852123-151852145 CTGATGACTGGCCTTCCTCTTGG - Intronic
1018582232 6:165317251-165317273 CTGGTTACTGGCCACCCTCTGGG + Intergenic
1019066414 6:169302913-169302935 CACGACACTGGCCCTGCACTGGG - Intergenic
1024228435 7:47346101-47346123 CTGGTCATTGCCCATTCACTCGG + Intronic
1024700804 7:51902071-51902093 CTGGGCCCTGGGCCTCCACCCGG + Intergenic
1025281421 7:57628419-57628441 CTGGTGCCTGGACGTCCACTGGG - Intergenic
1025303308 7:57837088-57837110 CTGGTGCCTGGACGTCCACTGGG + Intergenic
1027601914 7:80249830-80249852 TTGGTCACAGGCCATCCTCTGGG + Intergenic
1030881573 7:114887054-114887076 CTGGACAATGGGCCACCACTGGG + Intergenic
1031716668 7:125116952-125116974 CTGGCCATTACCCCTCCACTTGG + Intergenic
1032471513 7:132182436-132182458 CTGTTGACTGGGCCTCCACGGGG - Intronic
1034331392 7:150286268-150286290 CTGCTCACAGGCCCTTCGCTGGG + Intronic
1034666652 7:152823592-152823614 CTGCTCACAGGCCCTTCGCTGGG - Intronic
1035286492 7:157810415-157810437 CTGGGCACAGGCTCTCCACGGGG + Intronic
1035286503 7:157810450-157810472 CTGGGCACAGGCTCTCCACGGGG + Intronic
1035286606 7:157810764-157810786 CTGGGCACAGGCTCTCCACAAGG + Intronic
1035692072 8:1566739-1566761 ATGGTCACTGGCTCATCACTGGG - Intronic
1045245743 8:100440392-100440414 CTGCTCTCTCGACCTCCACTTGG - Intergenic
1045467504 8:102483971-102483993 CTGGTCACTGACTCTGAACTGGG + Intergenic
1046182419 8:110668956-110668978 CTGGCCACTGTCCCTCACCTTGG + Intergenic
1048973628 8:139658766-139658788 CTGGACACTGGCCCTGCACTTGG - Intronic
1054451255 9:65404562-65404584 CTGGTCACCCGTCCTGCACTAGG - Intergenic
1057339258 9:94184746-94184768 TTGGTCAGTGACCCTCTACTGGG - Intergenic
1057949270 9:99356828-99356850 CTGGCCACTGGCTCTTCCCTTGG + Intergenic
1059373996 9:113867434-113867456 GTAGTCACTGGCCCATCACTTGG - Intergenic
1060887189 9:127162754-127162776 CCGGACACTGGGCCTCCTCTTGG - Intronic
1062087471 9:134656204-134656226 CTGGTCACTGCCGCTGCACTGGG - Intronic
1062125410 9:134858090-134858112 CTGCTCACTGCCACCCCACTTGG + Intergenic
1062623032 9:137431144-137431166 CTGGGCAGAGGCCCTCCACATGG + Intronic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1186397446 X:9224169-9224191 CTGGTCAATGTCTCTCCATTAGG - Intergenic
1186959268 X:14717209-14717231 CTGTACCCAGGCCCTCCACTTGG - Intronic
1187157277 X:16732811-16732833 CTGGTCACTGGTCATCCGCTGGG + Intronic
1187309934 X:18132374-18132396 CTGATCACTGCCCTACCACTGGG + Intergenic
1187628266 X:21141381-21141403 CTGATCACTGGGCCTCCAGGTGG + Intergenic
1189716028 X:43867044-43867066 CTGGCCACTGGAGCTCCTCTTGG - Intronic
1192204934 X:69089461-69089483 CTGCCCACTGGCCCTCTTCTAGG + Intergenic
1192544759 X:72004387-72004409 CTGGTCACTGCCTGTCCCCTAGG - Intergenic
1193094169 X:77528264-77528286 ATGGCCGCTGGCCCTCCCCTGGG - Intronic