ID: 1067750024

View in Genome Browser
Species Human (GRCh38)
Location 10:48965329-48965351
Sequence TCTTCAGACTGGGACACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067750024_1067750031 19 Left 1067750024 10:48965329-48965351 CCCCAAGTGTCCCAGTCTGAAGA 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1067750031 10:48965371-48965393 CTCCATGCTGCTCCTGACAGGGG No data
1067750024_1067750030 18 Left 1067750024 10:48965329-48965351 CCCCAAGTGTCCCAGTCTGAAGA 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1067750030 10:48965370-48965392 ACTCCATGCTGCTCCTGACAGGG No data
1067750024_1067750029 17 Left 1067750024 10:48965329-48965351 CCCCAAGTGTCCCAGTCTGAAGA 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067750024 Original CRISPR TCTTCAGACTGGGACACTTG GGG (reversed) Intronic
905110870 1:35593537-35593559 TCTTCTGCCTTGGGCACTTGAGG - Intronic
906244834 1:44265858-44265880 GCTTCAGGCTGGGGCATTTGCGG + Intronic
907607761 1:55835999-55836021 TCTTCAAAGTGGGACTCGTGGGG + Intergenic
908716576 1:67077160-67077182 ACATCATACTGGGACACATGAGG + Intergenic
912260959 1:108111310-108111332 TCTTCCCACTGGGAAACATGAGG + Intergenic
912469865 1:109899188-109899210 TCTTCAGATTGGGAAGGTTGGGG - Intergenic
912930323 1:113953294-113953316 TCTTCAGACTGAAACACTTCAGG + Intronic
913052746 1:115131376-115131398 TCCTCTGCCTGGGTCACTTGAGG + Intergenic
913111864 1:115664247-115664269 TCTACAGCCTGGGACACCTGAGG + Exonic
915410433 1:155697421-155697443 TTCTCAGACTGGCACACTTACGG - Intronic
920572055 1:207024775-207024797 TCTTCTGCCTGTGACCCTTGGGG + Intronic
921987169 1:221324767-221324789 TCTTCAGCCTGTGCCACTTTGGG - Intergenic
923456736 1:234171225-234171247 TCTGCATACTGGGACCATTGAGG + Intronic
1062880906 10:977026-977048 TCTGCAAAATGAGACACTTGAGG + Intergenic
1063918138 10:10905086-10905108 TCTTCAGATGTGGAAACTTGAGG - Intergenic
1065337471 10:24668410-24668432 TGTTCAGACTGGGACAATGTGGG - Intronic
1067750024 10:48965329-48965351 TCTTCAGACTGGGACACTTGGGG - Intronic
1076243768 10:128930280-128930302 TCTTGACACTGGGGCCCTTGGGG - Intergenic
1078522852 11:12077281-12077303 TCTGCAGCCTGGGAACCTTGAGG + Intergenic
1078645505 11:13138354-13138376 ACATCAGACTGGAACACATGTGG + Intergenic
1080767129 11:35307373-35307395 TCATCTGACAGAGACACTTGGGG - Intronic
1082796457 11:57381419-57381441 TGTTCAGACTGGGGCATTTTAGG - Intergenic
1082911157 11:58375927-58375949 TCTCCAGCCAGGGACACTGGGGG - Intergenic
1083381324 11:62270928-62270950 TATTCAGTCTTAGACACTTGTGG - Exonic
1085527097 11:77170604-77170626 CCTTCAGACAGGGACTCTTCTGG - Intronic
1087176171 11:95097972-95097994 TCTTCAAACTGAAACACTTCTGG - Intronic
1088006692 11:104949582-104949604 CCTTCAGACTGAGGCAGTTGCGG + Exonic
1088224528 11:107605230-107605252 ACTCCAGCCTGGGACACTGGAGG - Intronic
1094723927 12:33092858-33092880 TGTCCAGATTGGGACCCTTGAGG + Intergenic
1096215999 12:49797596-49797618 TCTTCTTCCTGGCACACTTGGGG + Intronic
1098226658 12:68331899-68331921 ACTTCAGATTGGGACACCTGTGG - Intronic
1105242958 13:18624019-18624041 TCTGCAGTTTGGGACACTTAGGG - Intergenic
1105854461 13:24361992-24362014 CCTTCAGACTGAGGCACCTGGGG + Intergenic
1107045971 13:35992623-35992645 TTTTGAGACTGGGGCATTTGTGG - Intronic
1107528284 13:41256148-41256170 CCACCAGACTGGGCCACTTGAGG - Intronic
1108830114 13:54467132-54467154 TTTTAAGCCTGGGAAACTTGAGG - Intergenic
1110848505 13:80217485-80217507 TCTTAAGACTGGAACACCTGTGG - Intergenic
1111518841 13:89372458-89372480 TTTTCAGCCTGCCACACTTGAGG - Intergenic
1112088934 13:96061578-96061600 TGTTGAGACTGTGACACTTTTGG + Intergenic
1114277554 14:21161053-21161075 TCTTCTGACTGACACTCTTGTGG - Intergenic
1118684855 14:68281216-68281238 ATTTCAGACTGGGGCATTTGGGG + Intronic
1119569169 14:75655001-75655023 TGTTCAGAAGGGGAGACTTGAGG + Intronic
1121409615 14:93740550-93740572 TCTTCAGGCTGTGACACCTCTGG + Intronic
1123488336 15:20760612-20760634 TCTGCAGTTTGGGACACTTAGGG + Intergenic
1123544834 15:21329685-21329707 TCTGCAGTTTGGGACACTTAGGG + Intergenic
1125916378 15:43491720-43491742 TCTTCTAACTTGGACACATGTGG - Exonic
1127873023 15:63089031-63089053 GCTTGAGCCTGGGAGACTTGAGG - Intergenic
1128991082 15:72260897-72260919 TCTTCACATTGGGACACTGAGGG + Intronic
1129882975 15:79019176-79019198 TCCTCAGACTGGGCCTCCTGGGG - Intronic
1130694242 15:86114269-86114291 TCTTCAGCCTTGGACCCTTGGGG + Intergenic
1202953179 15_KI270727v1_random:56956-56978 TCTGCAGTTTGGGACACTTAGGG + Intergenic
1135959315 16:26982582-26982604 TCTGCACACTGGGACACTTGGGG - Intergenic
1137760192 16:50934296-50934318 TCTGCAAAATGGGAAACTTGCGG + Intergenic
1138575617 16:57905555-57905577 CATTCAGACTGGAGCACTTGGGG - Intronic
1138906879 16:61347220-61347242 TCTTAAGTCTGGGACACATGAGG - Intergenic
1140528770 16:75646677-75646699 ACTCCAGCCTGGGAGACTTGAGG - Intronic
1143337651 17:6185340-6185362 TGTTCAGACTGGGTAATTTGAGG + Intergenic
1143598134 17:7927919-7927941 TCTTTGGACTGAGACACCTGAGG - Intronic
1147313722 17:39608862-39608884 TCTTCAGACTTGGTTATTTGAGG + Intronic
1147642960 17:42016315-42016337 TCTTCAGGCTGGGTAATTTGAGG - Intronic
1147951461 17:44110212-44110234 TCTTGAGAATCAGACACTTGGGG - Intronic
1148809774 17:50283049-50283071 TGTTCAGAGTGGGAGGCTTGAGG - Intergenic
1149496974 17:57125123-57125145 TCTTCACACTGGGACCCAGGTGG - Intergenic
1152308997 17:79537859-79537881 TCATCCTCCTGGGACACTTGGGG - Intergenic
1153381132 18:4440398-4440420 TTTTCAGTATGGGACATTTGTGG + Intronic
1154445980 18:14435878-14435900 TCTGCAGTTTGGGACACTTACGG + Intergenic
1155834210 18:30558483-30558505 TGTTCATACTGGGATATTTGGGG - Intergenic
1156330782 18:36120031-36120053 TTTTCATTCTGGGAGACTTGGGG - Intronic
1158342102 18:56477680-56477702 TCTTCAAATTGGGTCCCTTGAGG + Intergenic
1158841101 18:61388464-61388486 TCTTCAGATTGAGACAGATGAGG - Intronic
1163812146 19:19440029-19440051 TGTTCAGACTGGGCAACTTGTGG + Intronic
1164818513 19:31225737-31225759 TTTTAAGACTGGGAGACTAGTGG - Intergenic
1167359398 19:49022176-49022198 TCTTCAGACAAGGAAACCTGAGG + Intergenic
1168472027 19:56647660-56647682 TCTACAGAGTGGGACATTTGTGG - Intronic
925929772 2:8697730-8697752 TCTGCAGATTGTGACACTTTGGG + Intergenic
926126906 2:10277581-10277603 CGTTCAGCCTGGGACACCTGAGG + Intergenic
926851385 2:17201614-17201636 TCTTCAGACTGGGAAACTGTAGG + Intergenic
927102846 2:19801115-19801137 TCTACAGTCTGGAACCCTTGGGG + Intergenic
927701474 2:25271625-25271647 TTTTCAGACTAGGGGACTTGGGG - Intronic
929484369 2:42341002-42341024 TCTGCAGGCTGGGGCACTTGAGG - Intronic
932337582 2:70939729-70939751 ACTACAGACTGGGACCCTAGAGG - Exonic
933977984 2:87527422-87527444 TCCTCAGAAGGGGACACTGGTGG + Intergenic
936315848 2:111423385-111423407 TCCTCAGAAGGGGACACTGGTGG - Intergenic
936629214 2:114182841-114182863 TGTTCAAACTGGGATACTTTTGG + Intergenic
936749984 2:115630298-115630320 TTTTTAGACTGAGACAGTTGGGG + Intronic
939902352 2:147865898-147865920 TTTTCCTACAGGGACACTTGAGG + Intronic
941657344 2:168158321-168158343 TTTTCAGACTGGAAAACTTCAGG - Intronic
942141463 2:172981362-172981384 TTTTGAAACTGGGACTCTTGGGG - Intronic
947934675 2:233993690-233993712 TCTTCCTACTTGGACTCTTGTGG + Intronic
1172895098 20:38294816-38294838 TATTCAGGCTGGGAAACTTAAGG - Intronic
1172967700 20:38850157-38850179 TGTTGAGCCTGGGACACTTCTGG - Intronic
1175949364 20:62575006-62575028 ACTGCAGACTGGGACGTTTGGGG + Intergenic
1176449999 21:6853979-6854001 TCTGCAGTTTGGGACACTTAGGG - Intergenic
1176828168 21:13718997-13719019 TCTGCAGTTTGGGACACTTAGGG - Intergenic
1176993690 21:15528716-15528738 TCTTTAAACTTGGACACTTCAGG - Intergenic
1181338261 22:22157598-22157620 TCCTCAGGCTGGGCCCCTTGAGG - Intergenic
1183567995 22:38630353-38630375 TCTTCAGACTGGCAGTCTAGTGG + Intronic
1184407789 22:44309737-44309759 CCTGGAGACTGGGAAACTTGTGG - Intronic
950149015 3:10671738-10671760 TCTTCAAACTAGGAAACTGGTGG + Intronic
951529350 3:23684163-23684185 AGCTCAGAATGGGACACTTGGGG - Intergenic
952990542 3:38827526-38827548 TTTTCTGGCTGGGACACCTGGGG + Intergenic
953386574 3:42509672-42509694 TCTTCAGCCTGGGTCCCTTCTGG - Intronic
957067772 3:75539719-75539741 TCTGCATAATGGGACTCTTGAGG + Intergenic
957779922 3:84805798-84805820 TCATCCCACAGGGACACTTGGGG - Intergenic
960018129 3:112916437-112916459 ACTTCAGACAGGGTCACTTCAGG + Intergenic
960547104 3:118928008-118928030 TCTTCAAACAAGGATACTTGGGG + Intronic
961315775 3:126034589-126034611 TGTTCAAACAGGGACACCTGCGG - Intronic
962709091 3:138070774-138070796 TCCTCAGTCAGGGACACATGTGG - Intronic
967836899 3:193972440-193972462 TCTTCAGCCTGGGGCTCTTCAGG - Intergenic
968274677 3:197431174-197431196 TCTTCAGACTTACAGACTTGAGG - Intergenic
971612750 4:28746343-28746365 ATTTCAGCCAGGGACACTTGGGG - Intergenic
972176572 4:36414932-36414954 TCTTTAGACTGGCACAATTATGG + Intergenic
977665983 4:99648232-99648254 TGTTCAAACCGGGACACTTCAGG - Intronic
982095737 4:151921581-151921603 TCTGCAGACTGTGAAACTTCTGG + Intergenic
982391492 4:154869118-154869140 GCTTCAGACTGGTTCACTAGAGG + Intergenic
985650040 5:1103139-1103161 TGTTCAGGCTGGGACACGGGGGG + Intronic
985928648 5:3037121-3037143 TCTTCAGCCAGGGACACATAGGG + Intergenic
986739677 5:10695162-10695184 TCTTCAGAGTGTGACAGTCGAGG + Intronic
989240011 5:39193112-39193134 TCCTCAGAGTAGGAGACTTGGGG + Intronic
991372754 5:65936632-65936654 TCTACAGAGTGAGACACTTTAGG + Intronic
994187295 5:96829184-96829206 TATTCGGACTGGGACCCTAGGGG - Intronic
995073627 5:107954555-107954577 TGTTCAGACTGGTACACAGGAGG + Intronic
997196063 5:131980827-131980849 TTTTCAGAATGGGATCCTTGGGG - Intronic
998991047 5:147817625-147817647 CCTAAAGACTGGAACACTTGAGG + Intergenic
1000873829 5:166610664-166610686 TCTGCACACTGGGATATTTGAGG + Intergenic
1001522704 5:172406238-172406260 CTCTCAGACTGGGACACTGGGGG - Intronic
1006814951 6:36843755-36843777 TTTTCAGAAGGGGACACTGGAGG + Intergenic
1007419638 6:41711896-41711918 TCTTCAGGCTGGGAAAGCTGAGG + Intronic
1007906908 6:45471086-45471108 TCTTGGGACGTGGACACTTGGGG + Intronic
1014594948 6:123323880-123323902 TCTTCACACTGGGAAGCTTCAGG - Intronic
1017883970 6:158583385-158583407 TTTTCACACTGGGACCCTTGGGG - Intronic
1018708799 6:166483058-166483080 TCTTCAGGCTGTGAGTCTTGGGG - Intronic
1018895614 6:168014383-168014405 TCTTCAGATTTGGATATTTGAGG + Intronic
1020714584 7:11655321-11655343 TTTTCAGGCTGGAACACTTCTGG + Intronic
1021126140 7:16852760-16852782 TGTTCAAACTGAGAGACTTGGGG - Intergenic
1026017746 7:66683989-66684011 TCAGCACATTGGGACACTTGAGG - Intronic
1027444590 7:78258254-78258276 TCTTCAGACTGTGGCAGCTGGGG + Intronic
1027464062 7:78492607-78492629 TGTTCAGAATGGGATAATTGAGG + Intronic
1027530717 7:79328393-79328415 TCTTCAGACTTGGACACAGAAGG + Intronic
1029061240 7:97800107-97800129 TCTTCTGCCTGGGAAAATTGTGG - Intergenic
1034073597 7:148210862-148210884 AATTCAGAGTGGTACACTTGGGG + Intronic
1035679586 8:1478216-1478238 CCTTCAGACTGGGACACTGGTGG + Intergenic
1037378371 8:18257775-18257797 TCTGCAGACTGGTTCACCTGTGG + Intergenic
1040922560 8:52638808-52638830 TCCTCAGAATGGGACATTAGAGG - Intronic
1050203590 9:3175019-3175041 TCTTCAGACTCAGCCACATGGGG + Intergenic
1050205437 9:3191523-3191545 TTTTCAGAAGGGGACACTTGAGG - Intergenic
1050428477 9:5536743-5536765 TCATCAAACTGGGATATTTGGGG + Intronic
1054873785 9:70074477-70074499 TCTGCACACTGGGACAGGTGAGG - Intronic
1055821286 9:80267525-80267547 TCTTCAGACTAGGAGATTAGTGG + Intergenic
1057134167 9:92675184-92675206 TTTTCAGCTTGGGACACTTCAGG + Intergenic
1059094470 9:111398194-111398216 TCCTCAGACTAGGAAGCTTGTGG - Intronic
1061685096 9:132269624-132269646 TCTTCATCCTCGGACATTTGAGG - Exonic
1203519183 Un_GL000213v1:30538-30560 TCTGCAGTTTGGGACACTTAGGG + Intergenic
1190357421 X:49618597-49618619 TCACCAGACTGTGACACCTGAGG - Intergenic
1190631618 X:52392613-52392635 TCTCCAGGCTGGGACACAGGAGG - Intergenic
1190999595 X:55646197-55646219 TCTCCAGGCTGGGACACAGGAGG - Intergenic
1192552907 X:72068336-72068358 GCTTCAGCCTGGAAGACTTGGGG - Intergenic
1194143998 X:90241456-90241478 ACTTGATACTGGGAGACTTGAGG + Intergenic
1195590357 X:106617741-106617763 TTTTCTGACTGGCACTCTTGAGG - Intronic
1200489762 Y:3810757-3810779 ACTTGATACTGGGAGACTTGAGG + Intergenic