ID: 1067750025

View in Genome Browser
Species Human (GRCh38)
Location 10:48965330-48965352
Sequence GTCTTCAGACTGGGACACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067750025_1067750029 16 Left 1067750025 10:48965330-48965352 CCCAAGTGTCCCAGTCTGAAGAC 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG No data
1067750025_1067750031 18 Left 1067750025 10:48965330-48965352 CCCAAGTGTCCCAGTCTGAAGAC 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1067750031 10:48965371-48965393 CTCCATGCTGCTCCTGACAGGGG No data
1067750025_1067750030 17 Left 1067750025 10:48965330-48965352 CCCAAGTGTCCCAGTCTGAAGAC 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1067750030 10:48965370-48965392 ACTCCATGCTGCTCCTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067750025 Original CRISPR GTCTTCAGACTGGGACACTT GGG (reversed) Intronic
907282726 1:53361688-53361710 GTCTTCTGGCTAGGACATTTAGG - Intergenic
911462983 1:98213990-98214012 GTCTGCAAACAGGGACAATTTGG + Intergenic
914201534 1:145489239-145489261 CACTTCAGATTGGAACACTTTGG - Intergenic
914480656 1:148062366-148062388 CACTTCAGATTGGAACACTTTGG - Intergenic
915566635 1:156717629-156717651 GACTTCAGATTGGCAGACTTGGG + Intergenic
916747354 1:167694738-167694760 GAGTCCACACTGGGACACTTAGG - Intronic
917182873 1:172318440-172318462 GTCTGCAAACAGGGACAATTTGG - Intronic
918207458 1:182322221-182322243 GGCTTAAGACTGGGACTTTTGGG + Intergenic
920230983 1:204469425-204469447 GTCTCCAGACAGGGAGCCTTTGG + Exonic
920590879 1:207217367-207217389 GTCTGCTGACTGGGCCACTTGGG - Intergenic
921987170 1:221324768-221324790 ATCTTCAGCCTGTGCCACTTTGG - Intergenic
922032163 1:221812126-221812148 GCCTCCACACTGGGACACTATGG + Intergenic
923813027 1:237341962-237341984 TCATCCAGACTGGGACACTTTGG - Intronic
1064895710 10:20233894-20233916 GACTTCAGCCTGGAACTCTTGGG + Intronic
1065337472 10:24668411-24668433 TTGTTCAGACTGGGACAATGTGG - Intronic
1065661587 10:28008838-28008860 GCCTTCTGACTAGGAAACTTGGG + Intergenic
1066789227 10:39044591-39044613 TCCTTTAGACTGGGACATTTTGG + Intergenic
1066983287 10:42439451-42439473 GTCTGCAAACAGGGACAATTTGG - Intergenic
1067750025 10:48965330-48965352 GTCTTCAGACTGGGACACTTGGG - Intronic
1076097093 10:127740447-127740469 GGCATCTGACTGGGGCACTTAGG - Exonic
1078079140 11:8191473-8191495 CTCTTCACACTGGGGCAGTTTGG + Intergenic
1078427544 11:11264183-11264205 AACTTCAGGGTGGGACACTTTGG + Intergenic
1079300950 11:19278528-19278550 TGCTTCAGACTGGGACACGTTGG - Intergenic
1080767130 11:35307374-35307396 GTCATCTGACAGAGACACTTGGG - Intronic
1082612791 11:55322263-55322285 GTCTGCAAACAGGGACAATTTGG + Intergenic
1082922716 11:58513231-58513253 GTCTTCAGAGTTGGACATGTGGG - Intergenic
1085203011 11:74713101-74713123 GGCTGCTGACTGGCACACTTAGG - Intronic
1086272875 11:85089071-85089093 GTTCTCAAACTGGGAGACTTTGG - Intronic
1087300501 11:96428087-96428109 TTCCTCAGACTGAGACACTTTGG + Intronic
1087322965 11:96685536-96685558 GTTTTCAGACTGTAATACTTTGG + Intergenic
1087583883 11:100093729-100093751 TTCTTGTGACTGGGCCACTTTGG - Intronic
1092009273 12:5096087-5096109 TTCTTCAGACCAGGACACTAAGG - Intergenic
1096743976 12:53713627-53713649 CACTCCAGGCTGGGACACTTGGG + Intronic
1098389662 12:69956146-69956168 TTTTTGAGATTGGGACACTTGGG + Intronic
1099305613 12:80951234-80951256 GTCTTCAGAATTTTACACTTAGG - Intronic
1099471765 12:83058818-83058840 CTCTTAATACTTGGACACTTGGG + Intronic
1099838588 12:87937883-87937905 GACTTCAGACTTGGACTTTTGGG + Intergenic
1101959980 12:109241699-109241721 GTCCTCAGATTGGTTCACTTAGG + Intronic
1104050926 12:125193229-125193251 GTCCTCAGATGGGGACACTGAGG + Intronic
1105242959 13:18624020-18624042 TTCTGCAGTTTGGGACACTTAGG - Intergenic
1106912889 13:34482203-34482225 GTCTGCAAACAGGGACAATTTGG + Intergenic
1108147775 13:47497934-47497956 GGCTTTGGAGTGGGACACTTAGG + Intergenic
1108154684 13:47573284-47573306 GACTTCGGACTTGGACATTTGGG + Intergenic
1109576270 13:64263508-64263530 GTCTTAAGACTTGGTGACTTAGG + Intergenic
1110422358 13:75326906-75326928 GCCATGAGACTTGGACACTTAGG - Intronic
1112052851 13:95661406-95661428 GTCTTCATACTGCAACACTAAGG + Intergenic
1113828062 13:113272241-113272263 GCCTTCAGACTGGAAGACTCCGG + Intergenic
1114194501 14:20465372-20465394 GAAATCAGATTGGGACACTTTGG - Intergenic
1114716163 14:24827115-24827137 GGCTTGAGCCTGGGACACTGAGG + Intronic
1115352204 14:32407483-32407505 CTCTTCAGACTGGGCCAGGTAGG - Intronic
1117097675 14:52314562-52314584 GTCCTCAGACTGGGAGTCATTGG - Exonic
1118103077 14:62627748-62627770 GGCTGTAGGCTGGGACACTTAGG - Intergenic
1118453109 14:65922038-65922060 GCCTTCTGACTGGGAGACCTGGG - Intergenic
1119922381 14:78458306-78458328 GTCTTCCAACAGGGACTCTTAGG + Intronic
1122222256 14:100247207-100247229 GTTTTAAGGCTGGGAAACTTAGG + Intronic
1122520695 14:102341588-102341610 CTCTTCAGACCAGGACACCTGGG + Exonic
1123488335 15:20760611-20760633 TTCTGCAGTTTGGGACACTTAGG + Intergenic
1123544833 15:21329684-21329706 TTCTGCAGTTTGGGACACTTAGG + Intergenic
1124389633 15:29242592-29242614 CTCTTCAGACAGGAACAGTTGGG + Intronic
1125657195 15:41367635-41367657 CTCTCCAAACTGGGAGACTTGGG + Intronic
1127093708 15:55492185-55492207 GTCTTCAGTTTGTGAAACTTTGG - Intronic
1128991081 15:72260896-72260918 TTCTTCACATTGGGACACTGAGG + Intronic
1129132227 15:73510380-73510402 GTCTGCAAACAGGGACAATTTGG + Intronic
1129134522 15:73535233-73535255 GTCTGCAAACAGGGACAATTTGG - Intronic
1130694241 15:86114268-86114290 GTCTTCAGCCTTGGACCCTTGGG + Intergenic
1132235291 15:100215629-100215651 GTCTGCTGACTGAGTCACTTAGG - Intronic
1132417266 15:101630516-101630538 GTCTGCAAACAGGGACAATTTGG - Intronic
1202953178 15_KI270727v1_random:56955-56977 TTCTGCAGTTTGGGACACTTAGG + Intergenic
1134084761 16:11348783-11348805 GTGTTAAAACTGGGACACTTGGG + Intronic
1135959316 16:26982583-26982605 CTCTGCACACTGGGACACTTGGG - Intergenic
1140733466 16:77877003-77877025 GTCTTAAGAGTGGGACGCTCAGG - Intronic
1143676880 17:8439975-8439997 GACTTCAGACTTGGGCAGTTTGG + Intronic
1143899354 17:10162119-10162141 ACCTTCAGACTGGGAGCCTTCGG - Intronic
1150520657 17:65864305-65864327 CTCTTCTGAAAGGGACACTTAGG - Intronic
1156330783 18:36120032-36120054 GTTTTCATTCTGGGAGACTTGGG - Intronic
1159201580 18:65192517-65192539 GTCTTCAGATTGTGTAACTTAGG - Intergenic
1163527367 19:17830066-17830088 ATCTACAGACTGGGAAACTGAGG + Intronic
1164289582 19:23855312-23855334 TCCTTTAGACTGGGACATTTTGG - Intergenic
1166766555 19:45254597-45254619 GTCTTCAGACGGGGACACCCAGG - Intronic
1168069470 19:53941816-53941838 GTCTGGAGACTGGGACTCCTGGG + Intronic
925929771 2:8697729-8697751 TTCTGCAGATTGTGACACTTTGG + Intergenic
926495627 2:13583140-13583162 GTCTCCAGTCTGAGAGACTTTGG + Intergenic
929489852 2:42386420-42386442 GTCCACAGGCTGGGCCACTTAGG + Intronic
929646826 2:43637000-43637022 GACTTCAGACTGGGAGACCAAGG + Intergenic
929720857 2:44365647-44365669 GTGTCCAGAATGGGGCACTTTGG + Intronic
931114849 2:59153490-59153512 GTATTCAGACTGGTACTTTTGGG - Intergenic
933404268 2:81838468-81838490 GTCTTTAGGCTGAGACAATTAGG + Intergenic
934118350 2:88816397-88816419 GACTTCAGACTTGGACTTTTGGG + Intergenic
934580374 2:95433109-95433131 GTCTTCAGACATAGAAACTTTGG + Intergenic
934599072 2:95643608-95643630 GTCTTCAGACATAGAAACTTTGG - Intergenic
935187842 2:100750547-100750569 GTCTTCATATTGGTACATTTAGG - Intergenic
936749983 2:115630297-115630319 GTTTTTAGACTGAGACAGTTGGG + Intronic
937857887 2:126685910-126685932 GGCTTCAGACTAGAACACCTAGG - Intronic
942056545 2:172189205-172189227 GTCTGCAAACAGGGACAATTTGG + Intergenic
943606336 2:189981470-189981492 GTCTTCTGAATGGAACATTTAGG + Intronic
943988424 2:194654509-194654531 GTTATCAGACATGGACACTTAGG - Intergenic
946515672 2:220408473-220408495 GTCTGCAAACAGGGATACTTTGG + Intergenic
947097562 2:226583381-226583403 GACTTCAGTTTGGAACACTTGGG - Intergenic
947230709 2:227883108-227883130 GTTTTCAGACTCAGACATTTTGG + Intronic
948821246 2:240548567-240548589 GTCTGCAAACAGGGACAATTTGG - Intronic
1172445802 20:34992898-34992920 GTCACCACACTGGGACACTAGGG - Intronic
1173455903 20:43201105-43201127 GTCTCCAGAGTGGCAAACTTAGG + Intergenic
1175415577 20:58798549-58798571 GTCATGAGAAGGGGACACTTAGG + Intergenic
1175838736 20:62013485-62013507 GTCTGCTGAGTGGGACACTGTGG - Intronic
1175949363 20:62575005-62575027 GACTGCAGACTGGGACGTTTGGG + Intergenic
1176450000 21:6853980-6854002 TTCTGCAGTTTGGGACACTTAGG - Intergenic
1176828169 21:13718998-13719020 TTCTGCAGTTTGGGACACTTAGG - Intergenic
1184984485 22:48120213-48120235 CTCTGCAGACAGGGACACTGAGG + Intergenic
949149448 3:747598-747620 GTACTCAGACTAGGACCCTTAGG - Intergenic
950676922 3:14559807-14559829 GTGTTCAGACGGGGAAACTGAGG - Intergenic
950984281 3:17344118-17344140 GTCTGCAAACAGGGACAATTTGG - Intronic
951323685 3:21277361-21277383 GTCTGCAAACAGGGACAATTTGG - Intergenic
951350036 3:21595303-21595325 GTCTTCACTCTGGCACACCTGGG + Intronic
957267626 3:77987073-77987095 GTCTGCAAACAGGGACAATTTGG + Intergenic
958506355 3:94983558-94983580 GTCTTCAGATTTGGACAGTATGG + Intergenic
961815974 3:129550571-129550593 GTCTTCAAACTAGGTCACTGAGG + Intronic
967415464 3:189212746-189212768 CTCTGCAGACTCAGACACTTGGG - Intronic
968231362 3:197006639-197006661 GGCTGCAAACTGGGACACCTCGG + Exonic
968383960 4:120323-120345 GTCTGTAAACTGGGGCACTTTGG - Intergenic
974388351 4:61232049-61232071 GTCTTCAGACTAGGAGACTGGGG - Intronic
974969092 4:68803203-68803225 GACTTCAGACAGGCAGACTTTGG + Intergenic
975062058 4:70015585-70015607 GTCTGCAAACAGGGACAATTTGG + Intergenic
977648621 4:99443263-99443285 GGCTTCACACTGGGTCACTTGGG - Intergenic
980233807 4:130078050-130078072 GGCTTCAGAAAGGGACCCTTGGG + Intergenic
981385824 4:144129535-144129557 ATCTTCAGACTGGCATGCTTTGG + Intronic
982653423 4:158116869-158116891 GTATTCAGATTGGCCCACTTAGG + Intergenic
985650039 5:1103138-1103160 GTGTTCAGGCTGGGACACGGGGG + Intronic
985928647 5:3037120-3037142 GTCTTCAGCCAGGGACACATAGG + Intergenic
987594143 5:19974168-19974190 GTTTTCAGACTGGTACAAATGGG + Intronic
988086387 5:26480106-26480128 GTCTGCAAACAGGGACAATTTGG - Intergenic
988891220 5:35618764-35618786 GTTGTCAGACTTGGAAACTTTGG - Intronic
989501789 5:42176878-42176900 GACTTTAGACTGGGACTTTTGGG - Intergenic
990232932 5:53734578-53734600 GTCATAAGACTGGGGAACTTGGG - Intergenic
991042210 5:62187981-62188003 GTCTTAAAACTGGGAAAATTCGG - Intergenic
991621253 5:68547551-68547573 GTCTCCAGATTGGGAGGCTTAGG + Intergenic
994129080 5:96204105-96204127 TTGTTGAGACTGGGACATTTGGG - Intergenic
994300941 5:98146683-98146705 TTGTCCAGAATGGGACACTTTGG - Intergenic
994733922 5:103528352-103528374 TTCATCAGACTGGGACATTAGGG - Intergenic
997196064 5:131980828-131980850 GTTTTCAGAATGGGATCCTTGGG - Intronic
997928269 5:138050688-138050710 GTCTTCAGAAGGGGTCACTTGGG + Intronic
998159201 5:139803650-139803672 GGCCTCAGACTGGGACAGTCCGG - Intronic
1001522705 5:172406239-172406261 GCTCTCAGACTGGGACACTGGGG - Intronic
1002101806 5:176861559-176861581 GGCTTCAGACTGGGAGGCCTGGG - Intronic
1002641646 5:180633318-180633340 CTGTACAGACTGGGACACTGAGG + Intronic
1002805350 6:568330-568352 GCCTTCAAGCTGGGACACTGTGG + Intronic
1006586415 6:35117544-35117566 GAGTTCAGACTTGGACAGTTAGG - Intergenic
1009378604 6:63002506-63002528 GTCTGCAAACAGGGACAATTTGG - Intergenic
1011531274 6:88323995-88324017 ATCTTCAGACTCGGACAGGTAGG - Intergenic
1011634307 6:89355972-89355994 GTCTTCTGACTCTGAAACTTGGG + Intergenic
1012094955 6:94946198-94946220 GTCTGCAAACAGGGACAATTTGG - Intergenic
1013035993 6:106383805-106383827 GTATTCACATTGGAACACTTAGG - Intergenic
1014154266 6:118092942-118092964 GACTTCAGACTTGGACTTTTGGG + Intronic
1017883971 6:158583386-158583408 TTTTTCACACTGGGACCCTTGGG - Intronic
1018708800 6:166483059-166483081 GTCTTCAGGCTGTGAGTCTTGGG - Intronic
1020632994 7:10662779-10662801 GTCTTCAGCCTGAGACAGTGAGG - Intergenic
1024084447 7:45881784-45881806 GTCTTCTGACAGGGTCCCTTGGG + Intergenic
1025014183 7:55425591-55425613 TTCTACAGACAGGGACACTGTGG - Intronic
1026923120 7:74170846-74170868 GACTTTGGACTGGGACACTTTGG + Intergenic
1036973590 8:13383060-13383082 GTTTTCTGACTGTGATACTTTGG - Intronic
1039190789 8:34971812-34971834 GTCTGCAGGATGGGACCCTTGGG + Intergenic
1041620879 8:59967585-59967607 GTTTTCAAAATGGGACTCTTTGG - Intergenic
1042621969 8:70716806-70716828 GACTTCAGACTTGGACTTTTAGG - Intronic
1043236747 8:77878289-77878311 GTCTGCAAACAGGGACAATTTGG + Intergenic
1044845330 8:96374699-96374721 CTCTCCAGACTGGGACTCTTTGG + Intergenic
1045017676 8:98013015-98013037 GTCTTCAGCCTGGGAGACTATGG - Intronic
1045357287 8:101400633-101400655 GTCTTCAGACTTGCACCCATGGG - Intergenic
1047427734 8:124761951-124761973 GTTTTCAGAGTGAGGCACTTGGG - Intergenic
1047621859 8:126615936-126615958 GTGTACAGACTGGGCCACATGGG + Intergenic
1047715974 8:127595703-127595725 GTCAACAGACTGGGAAAGTTGGG + Intergenic
1050203589 9:3175018-3175040 GTCTTCAGACTCAGCCACATGGG + Intergenic
1050428476 9:5536742-5536764 GTCATCAAACTGGGATATTTGGG + Intronic
1051472079 9:17455576-17455598 TTCTTCTTACTGGGATACTTAGG - Intronic
1053499874 9:38578094-38578116 GTCTTCAGAATGTGTCAATTTGG - Intergenic
1054473574 9:65557346-65557368 CTCTTCAGACTGTGTCACATGGG + Intergenic
1058226293 9:102368613-102368635 ATCTTCAGTCTGAGACACTTAGG + Intergenic
1058430765 9:104917023-104917045 GGGTGCAAACTGGGACACTTTGG + Intronic
1058811353 9:108642766-108642788 GTCTTCAATCTGGGACGGTTTGG - Intergenic
1061688646 9:132305746-132305768 TCCTTCAGTCTAGGACACTTAGG - Intronic
1203519182 Un_GL000213v1:30537-30559 TTCTGCAGTTTGGGACACTTAGG + Intergenic
1185717637 X:2355426-2355448 GTCTTCAGCCTGGGACGCAAAGG + Intronic
1191585651 X:62823785-62823807 ATCTGCAAACTGGGACAATTTGG - Intergenic
1192520814 X:71798638-71798660 GTCTGCAAACAGGGACAATTTGG + Intergenic
1192581809 X:72289172-72289194 GTCTCCAGTTTGGGACTCTTAGG + Intronic
1195205389 X:102594511-102594533 GTTTTCAAACTGGGACGCCTGGG - Intergenic
1197050193 X:122047778-122047800 CTCTTGAGACTGGGACCCTAAGG + Intergenic
1198576843 X:138019829-138019851 GTTTTCACACTTTGACACTTTGG + Intergenic
1199652577 X:149961169-149961191 ATATACAGACTGGGAAACTTGGG + Intergenic
1200215781 X:154367712-154367734 GTGTCCTGACTGGGACTCTTGGG - Exonic
1200903296 Y:8455373-8455395 ATCTGCAGACAGGGACAATTTGG + Intergenic