ID: 1067750026

View in Genome Browser
Species Human (GRCh38)
Location 10:48965331-48965353
Sequence TGTCTTCAGACTGGGACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067750026_1067750031 17 Left 1067750026 10:48965331-48965353 CCAAGTGTCCCAGTCTGAAGACA 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1067750031 10:48965371-48965393 CTCCATGCTGCTCCTGACAGGGG No data
1067750026_1067750029 15 Left 1067750026 10:48965331-48965353 CCAAGTGTCCCAGTCTGAAGACA 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG No data
1067750026_1067750030 16 Left 1067750026 10:48965331-48965353 CCAAGTGTCCCAGTCTGAAGACA 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1067750030 10:48965370-48965392 ACTCCATGCTGCTCCTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067750026 Original CRISPR TGTCTTCAGACTGGGACACT TGG (reversed) Intronic
900946368 1:5833439-5833461 TGTGTTCAGACTGTGCCCCTGGG - Intergenic
902573806 1:17363902-17363924 GATCTTCAGAGTGGGAAACTGGG - Exonic
903054538 1:20626277-20626299 TGTCTCCAGGCTGGGGCATTAGG + Intergenic
904731271 1:32593645-32593667 GTTCTTCAGACTGGGAAACATGG - Exonic
909013071 1:70355466-70355488 TTTCTTCAGAGTTTGACACTAGG - Intronic
909492974 1:76246377-76246399 TGTCTTTTAACTGGGGCACTTGG + Intronic
910619137 1:89234207-89234229 TGTCTTTTGACTGGGGCATTTGG + Intergenic
913233482 1:116761222-116761244 TCACATCAGGCTGGGACACTGGG - Intronic
918883244 1:190154870-190154892 GTTATTCAGACTTGGACACTTGG + Intronic
919810308 1:201405145-201405167 TTTCCTCAGACTGGGAGTCTGGG + Exonic
920590880 1:207217368-207217390 AGTCTGCTGACTGGGCCACTTGG - Intergenic
920849658 1:209619996-209620018 TGTTTTGAGAGTGGGACTCTGGG - Intronic
923859101 1:237875260-237875282 TGTCTCCAGGATGGGACCCTTGG - Intergenic
1064895709 10:20233893-20233915 TGACTTCAGCCTGGAACTCTTGG + Intronic
1067750026 10:48965331-48965353 TGTCTTCAGACTGGGACACTTGG - Intronic
1067926634 10:50515132-50515154 TGACTTGGCACTGGGACACTTGG - Intronic
1068637621 10:59364552-59364574 TTTCTCCACACTGGAACACTTGG - Intergenic
1069898534 10:71694175-71694197 TGTATTCAGACTTGGTCTCTCGG - Intronic
1070781499 10:79139993-79140015 TGTCTCCAAAATGGGGCACTGGG + Intronic
1072210666 10:93243948-93243970 TGTCTTCAAGGTGGGAAACTGGG - Intergenic
1074468958 10:113709425-113709447 TGTTTTCAGATGGAGACACTAGG + Intronic
1074900263 10:117810482-117810504 GGTTCTCAAACTGGGACACTTGG - Intergenic
1076000192 10:126907081-126907103 TGGATTCAGTCTGGGGCACTTGG + Intronic
1076287221 10:129312030-129312052 TCTGTTCAGAATGTGACACTTGG - Intergenic
1076504843 10:130964873-130964895 TTTCTTCTCCCTGGGACACTCGG - Intergenic
1076883040 10:133248697-133248719 TGTCCTGAGCCTGGGACACAGGG - Intergenic
1082911159 11:58375929-58375951 TTTCTCCAGCCAGGGACACTGGG - Intergenic
1083613497 11:64015386-64015408 GGTCTTCAGACTTGGGCACAGGG + Intronic
1085272163 11:75276894-75276916 TGTCTGCATACTGGCGCACTAGG + Exonic
1088915015 11:114220954-114220976 TGTCTTCAACCAGGGAAACTAGG - Intronic
1090067421 11:123515147-123515169 TGGTTTCTGACTGGGTCACTTGG + Intergenic
1092745942 12:11672759-11672781 TTTCTTAAGACTTGGCCACTCGG - Intronic
1092770786 12:11894686-11894708 TGTATTCAGACTTGGAGCCTAGG - Exonic
1092928687 12:13295030-13295052 TCTCTTAAGACTGGGACAACAGG + Intergenic
1093381387 12:18498816-18498838 AGTATTTAGAGTGGGACACTTGG - Intronic
1098214841 12:68204540-68204562 TGTCTTCTACCTGGGAAACTTGG + Intronic
1098414304 12:70215442-70215464 GGTCTGGAGACTGGGACAGTTGG + Intergenic
1099471764 12:83058817-83058839 TCTCTTAATACTTGGACACTTGG + Intronic
1099817101 12:87663984-87664006 TTTCTTCAGACTGTGACATTTGG + Intergenic
1100897616 12:99202115-99202137 TGTCTTCACACTATGACAATTGG + Intronic
1102082285 12:110108180-110108202 CGTCTTCAGACTGGGATACTGGG - Intergenic
1104711394 12:130989399-130989421 TGTCTTCAGACCAGGTCACCAGG - Intronic
1105068993 12:133222524-133222546 TGTCTTCACATTGGGACAAGAGG - Intronic
1106462024 13:29979397-29979419 TGACTTTGGACTGGGCCACTTGG - Intergenic
1109714400 13:66202622-66202644 TGTCTTGAGAATGGCACAGTTGG - Intergenic
1115195765 14:30797693-30797715 TGTACTGAGACTGGGAGACTGGG - Intergenic
1115880235 14:37908384-37908406 AGGCTTGAGACAGGGACACTGGG + Intronic
1118443795 14:65834327-65834349 TGTCCTCAAGCTGGGACAGTTGG - Intergenic
1119201770 14:72758354-72758376 AGTCTCCAGACTGGAACACAAGG + Intronic
1121003871 14:90473891-90473913 TGGCTTCAGAATGGAACCCTTGG - Intergenic
1122921712 14:104882998-104883020 TGTCTTCAGACCGGGCCTCAGGG - Intronic
1122952270 14:105051590-105051612 TGTCTTCCGTCTGGAACACCGGG + Exonic
1125161125 15:36644997-36645019 TGTCTTCAGACTGTACCACAAGG - Intronic
1126036907 15:44555017-44555039 TGTCTTAAGACTTAGACAGTAGG + Intronic
1127325718 15:57893380-57893402 TGTTTTCAAACTGGACCACTAGG - Intergenic
1127646201 15:60961848-60961870 TGTTTTCAGGCTGGGACCCCAGG - Intronic
1128981477 15:72190583-72190605 TGTTTTCACATGGGGACACTTGG + Intronic
1130694240 15:86114267-86114289 TGTCTTCAGCCTTGGACCCTTGG + Intergenic
1130848686 15:87772063-87772085 TGTCTGCAAACTGAGACAATTGG - Intergenic
1131320965 15:91390726-91390748 TGTCCACTGAGTGGGACACTGGG - Intergenic
1134084760 16:11348782-11348804 AGTGTTAAAACTGGGACACTTGG + Intronic
1135619269 16:23940779-23940801 GGTGTTCAGACTGGTACTCTCGG + Intronic
1135959317 16:26982584-26982606 ACTCTGCACACTGGGACACTTGG - Intergenic
1137717388 16:50606645-50606667 TGTCTTTTTACTGGCACACTTGG - Intronic
1140533049 16:75683564-75683586 TGTCTGGAGATTGAGACACTAGG + Intronic
1142904576 17:3033513-3033535 TGTGGCCAGACTGGGACACCTGG - Exonic
1143961590 17:10725680-10725702 TGGCTTCAGACTGGTGGACTCGG - Intronic
1144329824 17:14213307-14213329 TGTCCTCAAACTGGGACCCCGGG - Intergenic
1144538688 17:16116568-16116590 TGTTTTCAGACTGGGATTTTGGG - Intronic
1147407854 17:40226166-40226188 TGTATTCAGATTGGGATAGTTGG + Intronic
1148255412 17:46127021-46127043 TCTCATCAGACTGGCAGACTGGG + Intronic
1148470350 17:47889293-47889315 TGTTTTCAGACAGGGAGACAGGG + Intergenic
1153471352 18:5450013-5450035 TGTTTTCAGACTGTGACTGTGGG + Intronic
1154010369 18:10569016-10569038 TGTCTTCAGAGATGGACGCTTGG + Intergenic
1156924472 18:42558969-42558991 TGTCTTCAGACTCTGAAACGAGG + Intergenic
1158124806 18:54089420-54089442 TGTCTTCTGGCCTGGACACTAGG + Intergenic
1164695294 19:30239437-30239459 GCCCTTCAGACTGGGACTCTTGG + Intronic
925715209 2:6778582-6778604 TGTCTTCATATTCGGATACTGGG + Intergenic
926849025 2:17174476-17174498 TGTCTTCTTACTGGCACAGTTGG + Intergenic
929685938 2:44034770-44034792 TGTTTTCAGACAGGAAAACTGGG + Intergenic
931114850 2:59153491-59153513 TGTATTCAGACTGGTACTTTTGG - Intergenic
935612351 2:105038314-105038336 TGCCTTCAGGCAGGGACTCTAGG + Intronic
935622407 2:105141726-105141748 TCTCTTCAGTCTGAGACCCTGGG - Intergenic
940041960 2:149370287-149370309 TTACTTCAGACAGGGACACTGGG - Intronic
948377560 2:237531435-237531457 TGTCTTCAGGCTAGGAGACTAGG - Intronic
948386647 2:237584914-237584936 TGTCTGCAGAGGGGGACCCTGGG - Intronic
1172445803 20:34992899-34992921 CGTCACCACACTGGGACACTAGG - Intronic
1172592801 20:36129230-36129252 TGTCTTCAGAATAGGACTCTTGG - Intronic
1172820799 20:37732446-37732468 TATCTTAAGATGGGGACACTGGG - Intronic
1173957109 20:47042043-47042065 TGTCTTCAGATTTGGATACTTGG - Intronic
1174223048 20:48972660-48972682 TCTCGTCAAACTGGGACACTTGG + Intronic
1176066500 20:63199590-63199612 TGTCTTGAGGCTGAGACTCTGGG - Intronic
1181414542 22:22749878-22749900 TGCTTCCAGTCTGGGACACTAGG + Intronic
1184954683 22:47878048-47878070 AGTGTTCAGTTTGGGACACTTGG - Intergenic
953019282 3:39103641-39103663 TGTGTTCTGGCTGGCACACTGGG - Intronic
953485158 3:43287259-43287281 TTTTTGCAGACTGGGAGACTGGG + Intronic
954221761 3:49159149-49159171 AGCCTTCAGGCTGGGGCACTGGG + Intergenic
959756634 3:109907209-109907231 TGTCAGCAGACAGGGACAGTTGG + Intergenic
961914263 3:130354734-130354756 TCTCTTTAGCCTGGGACTCTGGG + Intronic
962288135 3:134105805-134105827 TGACTTCAGACTGAGACCCAGGG + Intronic
964246841 3:154663688-154663710 TGTCCTCAGCATTGGACACTGGG + Intergenic
967007552 3:185398934-185398956 AGTCTTCTGAATAGGACACTTGG - Intronic
967279888 3:187811735-187811757 TGACTTCAGGCAGGGTCACTGGG + Intergenic
967415465 3:189212747-189212769 TCTCTGCAGACTCAGACACTTGG - Intronic
968491339 4:892129-892151 TGTCCTCAGACAGGGACTCCGGG + Intronic
970005319 4:11405336-11405358 TGTCTTCACAGTGGGACTCGAGG - Intronic
970753151 4:19390536-19390558 TGTCTGCAAACTGGGAAATTTGG - Intergenic
973826187 4:54709484-54709506 TGACGTCAGAATTGGACACTAGG - Exonic
974388352 4:61232050-61232072 TGTCTTCAGACTAGGAGACTGGG - Intronic
975636920 4:76459402-76459424 TGTCTTCAGACTATGACAAGAGG - Intronic
977411696 4:96674364-96674386 TGTCTTCAAGCTGGGACAACAGG + Intergenic
977648622 4:99443264-99443286 AGGCTTCACACTGGGTCACTTGG - Intergenic
979564021 4:122134133-122134155 TGTCTTCAGACTGCCATACCGGG + Intergenic
981034726 4:140157627-140157649 TTTCTTGTCACTGGGACACTAGG - Intergenic
981911343 4:149984950-149984972 TGTAATCAGACTGAGACACAAGG - Intergenic
982614325 4:157621898-157621920 TGTCTGCATAATGGGAGACTTGG - Intergenic
985650038 5:1103137-1103159 AGTGTTCAGGCTGGGACACGGGG + Intronic
986260343 5:6140109-6140131 AGTCTTCAGATTGAAACACTGGG + Intergenic
986261791 5:6153845-6153867 TGTCTCCAGTCAGAGACACTAGG + Intergenic
989101406 5:37826636-37826658 TGTCTTCAGACTGAGGCACCTGG + Intronic
990232933 5:53734579-53734601 TGTCATAAGACTGGGGAACTTGG - Intergenic
990410525 5:55536157-55536179 TTCCTCCAGACTGGAACACTGGG - Intergenic
992558269 5:77924533-77924555 ATTCTTCAGACTGGAAGACTGGG - Intergenic
993007557 5:82444684-82444706 TGTCTTCAGCCAGGGCCACTCGG - Intergenic
994733923 5:103528353-103528375 TTTCATCAGACTGGGACATTAGG - Intergenic
997928268 5:138050687-138050709 TGTCTTCAGAAGGGGTCACTTGG + Intronic
998496977 5:142599375-142599397 TGTGTTCACATTGGGACCCTTGG + Intronic
1001522706 5:172406240-172406262 TGCTCTCAGACTGGGACACTGGG - Intronic
1005110757 6:22279710-22279732 TTTCTCCAGACTGGGTCACTGGG + Intergenic
1006905644 6:37531656-37531678 TGTCTTCAGAGAGGGAAGCTGGG + Intergenic
1010750000 6:79607372-79607394 TGCCTTCTGCCTGGTACACTGGG - Intergenic
1010774245 6:79867011-79867033 TGTCCTCAAAATGGAACACTAGG + Intergenic
1010803106 6:80200965-80200987 TGACTTCGGCCTGGGACAGTGGG - Exonic
1011208468 6:84928122-84928144 TGTTTCTAGTCTGGGACACTAGG - Intergenic
1013484050 6:110578370-110578392 TGTCTTTTTACTGGGACATTTGG - Intergenic
1013751349 6:113410071-113410093 TATCCTCAGACTGGGACTCCTGG - Intergenic
1015306910 6:131719243-131719265 TTTCTCCTGCCTGGGACACTTGG - Intronic
1017304380 6:152899309-152899331 AGCCTTCAGACATGGACACTGGG + Intergenic
1022131640 7:27410118-27410140 TCTCTTCATACTGGGCTACTCGG - Intergenic
1028917668 7:96277543-96277565 TGTTTTCCCACAGGGACACTTGG + Intronic
1032608349 7:133383358-133383380 TGTCTACAGATGGGGACAGTGGG + Intronic
1033712242 7:143960020-143960042 TGTCCAGTGACTGGGACACTCGG + Exonic
1035223696 7:157421943-157421965 TGTTCTCAGGCTGTGACACTGGG + Intergenic
1035795824 8:2355659-2355681 TGTGAACAGACGGGGACACTGGG + Intergenic
1036760617 8:11506290-11506312 TGTCTTCAGGCTGTGACCTTGGG - Intronic
1036994311 8:13637349-13637371 TGTCTTCAAGCTGAGACACTGGG - Intergenic
1039550291 8:38438568-38438590 TATCTTCAGAGGGGGAAACTGGG + Intronic
1042049978 8:64693012-64693034 TGTCTTAATGCTGGGACACTTGG - Intronic
1043514656 8:80984991-80985013 TGCCTTCAGTCTGGGGCCCTGGG + Exonic
1047621858 8:126615935-126615957 TGTGTACAGACTGGGCCACATGG + Intergenic
1047861246 8:128969771-128969793 TGTCTTTGAACTGGGACAATTGG - Intergenic
1049944316 9:579692-579714 GGTCTTCTGACTGGGCCACAGGG - Intronic
1050203588 9:3175017-3175039 TGTCTTCAGACTCAGCCACATGG + Intergenic
1057201322 9:93141901-93141923 TTTCTACAGACGGGGAAACTGGG + Intergenic
1058113752 9:101060996-101061018 AGTCTTCATACTGAGACACTAGG - Intronic
1059514170 9:114877278-114877300 TGTCTTCACACTTGGACACATGG + Intergenic
1188019551 X:25142585-25142607 TGTTTGCACACTGGGAGACTTGG + Intergenic
1189344717 X:40232365-40232387 TGTCTTCAGATAGAGAGACTAGG - Intergenic
1190236213 X:48617636-48617658 TGCCCTCAGTCTGGGTCACTGGG - Intergenic
1190980995 X:55456567-55456589 TGTTTTCAAACTTGGACACATGG + Intergenic
1190987702 X:55516613-55516635 TGTTTTCAAACTTGGACACATGG - Intergenic
1195205390 X:102594512-102594534 TGTTTTCAAACTGGGACGCCTGG - Intergenic
1200075538 X:153548881-153548903 TGTTTACAGACTCGGAAACTGGG + Intronic
1200215782 X:154367713-154367735 TGTGTCCTGACTGGGACTCTTGG - Exonic
1201546876 Y:15175226-15175248 TATTTTCAGACTGGGATATTGGG - Intergenic
1202149611 Y:21832860-21832882 TGTCTTCTCAGTGGGACACAGGG + Intergenic