ID: 1067750027

View in Genome Browser
Species Human (GRCh38)
Location 10:48965339-48965361
Sequence TGCAATCTTGTCTTCAGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067750027_1067750031 9 Left 1067750027 10:48965339-48965361 CCCAGTCTGAAGACAAGATTGCA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1067750031 10:48965371-48965393 CTCCATGCTGCTCCTGACAGGGG No data
1067750027_1067750030 8 Left 1067750027 10:48965339-48965361 CCCAGTCTGAAGACAAGATTGCA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1067750030 10:48965370-48965392 ACTCCATGCTGCTCCTGACAGGG No data
1067750027_1067750029 7 Left 1067750027 10:48965339-48965361 CCCAGTCTGAAGACAAGATTGCA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067750027 Original CRISPR TGCAATCTTGTCTTCAGACT GGG (reversed) Intronic
905901751 1:41585980-41586002 TGCAGTTTTGTCTTCAAACATGG - Intronic
907975187 1:59424706-59424728 GGCAATTATGTCTTCACACTTGG + Intronic
908317993 1:62953292-62953314 TGCAAAATTGTTTGCAGACTAGG + Intergenic
908446625 1:64203758-64203780 TCCAAGTTTGTCTTGAGACTGGG + Intronic
917744371 1:177993560-177993582 TGCAATATTGTCTTAGGATTGGG - Intergenic
918101820 1:181382973-181382995 AGCCATCTTGTCTTAAGACAAGG + Intergenic
922528203 1:226322665-226322687 GAAAATCTTGTTTTCAGACTAGG + Intergenic
923925885 1:238626844-238626866 TGCTATCTGGTTCTCAGACTTGG - Intergenic
924135190 1:240958360-240958382 TTCAATCTAGTCTCCAGATTTGG - Intronic
1062913355 10:1228886-1228908 TTAAATCATCTCTTCAGACTGGG - Intronic
1067750027 10:48965339-48965361 TGCAATCTTGTCTTCAGACTGGG - Intronic
1069507540 10:69014346-69014368 TGCCTTCTTTTCTTCAGTCTAGG - Intronic
1070442322 10:76458946-76458968 TGCTATTTTGTCTTGACACTTGG - Intronic
1070499366 10:77055973-77055995 TCCAATATTGCCCTCAGACTGGG - Intronic
1074781088 10:116802850-116802872 TTCAAACTTCTGTTCAGACTTGG - Intergenic
1075543064 10:123331670-123331692 TGAAATCGTGTTTTCAAACTGGG + Intergenic
1078444632 11:11394978-11395000 TGCTGAGTTGTCTTCAGACTGGG - Intronic
1085392468 11:76189473-76189495 TGGAATATTGTCTGCAGATTAGG + Intronic
1086000603 11:81979923-81979945 TGCAAACATGTTTTCACACTTGG + Intergenic
1086909619 11:92457406-92457428 TGCAGGCTTGTATTCACACTGGG + Intronic
1087837751 11:102891777-102891799 GGGAAGCTTGTCTTCTGACTTGG - Intergenic
1090524887 11:127522389-127522411 TGAAACCATATCTTCAGACTGGG + Intergenic
1091205802 11:133820156-133820178 TCCAATCTAGTCTCCAGACAGGG + Intergenic
1093094040 12:14952377-14952399 TGCAATGCTGTTTTCAGAGTTGG - Intronic
1094532867 12:31293888-31293910 TTCAATGTAGTCTTTAGACTGGG + Exonic
1095602910 12:44034581-44034603 TGCAGTCTTGAATTCAGAGTGGG + Intronic
1095774282 12:45995037-45995059 TGCCATCAGGTCTTCAGACTTGG + Intergenic
1096013538 12:48244730-48244752 TGCAATCTTATGATCAAACTTGG + Intergenic
1096176935 12:49527904-49527926 TACAGTCTGGGCTTCAGACTTGG - Intergenic
1098821443 12:75235588-75235610 TGAATTCTTGTGTTTAGACTTGG - Intergenic
1102259571 12:111436009-111436031 TGCCATCTTGTCCTCAGAAGTGG + Intronic
1106020028 13:25905664-25905686 TGCAATCTACTCTCCAGCCTCGG + Intronic
1106075775 13:26459690-26459712 TGTAATCTTGTCTGCTGACAAGG + Intergenic
1106082453 13:26511642-26511664 TTCAATCTGGTCTTCAAACTGGG - Intergenic
1106402482 13:29443607-29443629 TGCAATCTCAGCTGCAGACTGGG - Intronic
1109405202 13:61889071-61889093 TGAATTTTTGTGTTCAGACTTGG + Intergenic
1113151264 13:107266811-107266833 TGCAAAGTTTTCTTCAGATTAGG + Intronic
1115716482 14:36110699-36110721 TCCAATCCTGTCTTCTGTCTTGG + Intergenic
1116267530 14:42712822-42712844 TGAAGTTTTGTCTTTAGACTTGG + Intergenic
1117008374 14:51445303-51445325 AGGAATGTTCTCTTCAGACTTGG - Intergenic
1117885586 14:60358226-60358248 TGCAGTTTTGTCTTAAGACATGG - Intergenic
1119883930 14:78124429-78124451 TAGAATCTTGTCTTGAGGCTTGG + Intergenic
1121537627 14:94701759-94701781 TTCAATCTTGTTTTCCAACTGGG + Intergenic
1122580906 14:102771042-102771064 TGCAGACTTGTCCTCAGCCTCGG + Intergenic
1125379669 15:39074522-39074544 TGCAATCTTTTGTTCTGAGTGGG - Intergenic
1128331872 15:66761340-66761362 TACAATGTTATCTTCAGAATAGG + Intronic
1129518700 15:76172220-76172242 TGCAATCTCTTTTACAGACTGGG - Intronic
1130835099 15:87642593-87642615 TCCAATCTTGCCTCCTGACTTGG - Intergenic
1135493946 16:22935253-22935275 TGAAATATTGTTTTCAGCCTAGG + Intergenic
1137901452 16:52273416-52273438 TTCAATCTTGGCTACACACTAGG - Intergenic
1143958060 17:10690283-10690305 TGCAAACTATTCATCAGACTAGG + Intronic
1144116048 17:12091742-12091764 TGCAATCTTGAATACAGATTTGG + Intronic
1155478155 18:26256085-26256107 TTCAATGTAGTCTTTAGACTGGG + Intronic
1157302219 18:46487270-46487292 TGAAATCTTGCCTTCATCCTGGG + Intronic
1157316384 18:46593483-46593505 TACATTTTTGTCTTCAAACTTGG + Intronic
1157410393 18:47458374-47458396 TGCAATCTGGTTTTAGGACTAGG + Intergenic
1158730461 18:60017169-60017191 TTCAATGTAGTCTTTAGACTGGG + Intergenic
1159815861 18:73072975-73072997 AGCCATGTTTTCTTCAGACTGGG - Intergenic
1161886425 19:6999890-6999912 TGCACTCTTGTTGTCAGACATGG + Intergenic
1163792934 19:19318836-19318858 GACAATGATGTCTTCAGACTAGG + Intronic
1164283080 19:23786380-23786402 CACAATCTTATCTTCAGACTGGG - Intronic
1164294570 19:23898472-23898494 CACAATCTTACCTTCAGACTGGG - Intergenic
1168038937 19:53742640-53742662 TGCATGCTTATCATCAGACTTGG + Intergenic
925355680 2:3239467-3239489 GGCAGTTTTGTCTTCAGATTTGG + Intronic
929520547 2:42646664-42646686 TGCAATCTTGTGGTAAAACTTGG + Intronic
933643315 2:84787432-84787454 TACAATCTTGTCTTCACACAAGG - Intronic
934843183 2:97644569-97644591 TGAGATCATGTCTTGAGACTTGG + Intergenic
935022278 2:99243209-99243231 AGCAATCTGGTTTTCAGGCTGGG + Intronic
937830111 2:126410455-126410477 TGCAGTCTTGCATTTAGACTGGG - Intergenic
939588775 2:144037433-144037455 TGCCACCTTGTATCCAGACTTGG + Intronic
942075602 2:172354598-172354620 TGCAATGTTGTCATCACTCTTGG + Intergenic
945342179 2:208669308-208669330 TTAAACCTTGTCTTCAGTCTAGG - Intronic
1168775101 20:440738-440760 TGCAGTCATGTTTTCAGGCTTGG - Intronic
1169564198 20:6835434-6835456 TGAAAGCTGGACTTCAGACTGGG + Intergenic
1174034069 20:47655794-47655816 TGCAATCCTTTCCTCAGACCTGG + Intronic
1174948705 20:55018959-55018981 TGCAATTTTGTTTTGAGCCTGGG + Intergenic
1179471985 21:41616735-41616757 AGGAATCTAGTCTTCAGACGAGG - Intergenic
954846178 3:53559583-53559605 TGCAATCTATTGTTCAGTCTGGG + Intronic
961594811 3:128007641-128007663 TGCATTCTTTTTTTCATACTAGG + Intergenic
963045738 3:141101375-141101397 AGCACTTTTGTCTTCAGCCTGGG + Intronic
963516122 3:146310614-146310636 TGCAAACTATTCTTCTGACTAGG - Intergenic
964062336 3:152538935-152538957 TGCAATCTGGTCTTGAGAAGAGG + Intergenic
964152783 3:153548058-153548080 TGAAACCTTGTCTTCTGGCTTGG + Intergenic
964415220 3:156440404-156440426 TGGAAACTTGTCTTCAGGCCAGG + Intronic
966076359 3:175940470-175940492 TGCAATCTAGTCTTAAGAGGAGG + Intergenic
967121801 3:186388935-186388957 TTCAATGTTATCTTCAGATTTGG + Intergenic
967625663 3:191680942-191680964 AGCAATCTTTTCTTGAGGCTAGG + Intergenic
967869840 3:194220795-194220817 TTCAATCTTGGCTTCAGTGTAGG + Intergenic
970362473 4:15323560-15323582 TGAACTCTTGCCTTCTGACTGGG + Intergenic
972451203 4:39200408-39200430 TGCAATCGTGTTGTCAGACAGGG + Intronic
976060311 4:81120071-81120093 TTCAATCTTGTCTACCTACTAGG - Intronic
978738322 4:112109433-112109455 AGAAAACTTGTCTACAGACTGGG + Intergenic
980823880 4:138051036-138051058 TGCAATATTGTGTTCAAAGTAGG + Intergenic
982557455 4:156885845-156885867 TGCACTCTAGTCTGCAGACTGGG + Intronic
982860141 4:160438086-160438108 TGCAATCTACTCTTCTGACAAGG + Intergenic
982934822 4:161459754-161459776 TGAAATCTTGTAATCAGAATTGG - Intronic
986460604 5:7967150-7967172 TGCAATGTTGTCTTCAAAGATGG + Intergenic
987817809 5:22926761-22926783 TGCAATAATGTATACAGACTAGG + Intergenic
988955331 5:36310620-36310642 TCCCACCTTTTCTTCAGACTAGG - Intergenic
995049502 5:107686625-107686647 TGCAGTCCTTTCTTCATACTGGG - Intergenic
997091037 5:130858511-130858533 TGCAATATTGTGTTCAGAGTAGG - Intergenic
997398196 5:133581371-133581393 TTCAATCTCCTCTTCAGACGAGG - Intronic
1000591032 5:163157659-163157681 GGGAAGCTTGTCTTCAGAGTGGG + Intergenic
1009459687 6:63897432-63897454 TGCTATCTCTTCTTCAGTCTGGG - Intronic
1012177141 6:96101663-96101685 TGAAATCTTGTCTCCAGAATTGG - Intronic
1016030395 6:139331799-139331821 TGAAAACTTGTCTTCAGGCCAGG + Intergenic
1018452943 6:163925766-163925788 TGCAATCTAGTCATCACAATTGG - Intergenic
1020660048 7:10971597-10971619 TGCAATATTGTCTTCTGGATTGG + Intergenic
1024145061 7:46506301-46506323 TGCAAACTAGTCTTCTGACAAGG + Intergenic
1024382386 7:48712617-48712639 TGCTATCTGTTATTCAGACTGGG + Intergenic
1027563647 7:79763781-79763803 TGCAGTCTAGTCTTTAGACTGGG - Intergenic
1028675051 7:93449962-93449984 TGCGCTATGGTCTTCAGACTGGG + Intronic
1029248649 7:99220522-99220544 TTAAATCTTGTTTTCAGACAGGG + Intergenic
1029549236 7:101228327-101228349 GGCAATTGTGTCTTCAGTCTTGG + Intergenic
1040548437 8:48420151-48420173 TGCAATCCTTCCTCCAGACTGGG + Intergenic
1041181053 8:55248436-55248458 TGCAATCTGACTTTCAGACTTGG - Intronic
1042884612 8:73534323-73534345 TGCTATTTTGTCTTAAGATTTGG - Intronic
1045288002 8:100808445-100808467 TCCAATCCTTTCTTCAGATTAGG - Intergenic
1046374063 8:113352435-113352457 TAACATCTTGACTTCAGACTTGG + Intronic
1047978091 8:130151468-130151490 AGAAATCCTGTCTACAGACTTGG - Intronic
1048043123 8:130749817-130749839 TGCCATCTTCTGGTCAGACTGGG - Intergenic
1051973500 9:22920535-22920557 TGAAATCATCTCTTCAGCCTAGG + Intergenic
1055528892 9:77163643-77163665 TGAAATCTTGTTTTCAGGCCCGG + Intergenic
1056001788 9:82225521-82225543 TACAATGTAGTCTTCAGACGTGG - Intergenic
1057064379 9:92034908-92034930 TGCAACCTGGACTTCAGACATGG + Intronic
1059551868 9:115237205-115237227 TGAAAACTTGAGTTCAGACTTGG + Intronic
1059564910 9:115374347-115374369 TTCTATCATGTGTTCAGACTGGG + Intronic
1059836102 9:118155191-118155213 TGCAATCTTCTCTACAGCCTTGG - Intergenic
1061779396 9:132986879-132986901 TGCACTCCTGTTTCCAGACTTGG - Intronic
1187128284 X:16475089-16475111 TGTCATCTCATCTTCAGACTGGG + Intergenic
1189170498 X:38905091-38905113 TACAAGCTTGTCCTCAGTCTGGG + Intergenic
1191026721 X:55921705-55921727 TGCAATCTATCCTTCAGACAAGG + Intergenic
1193223645 X:78956319-78956341 TAAAATGTTGTCTTCTGACTTGG - Intronic
1193549736 X:82877038-82877060 AGCATTCTTGTCTTGATACTGGG - Intergenic
1195206263 X:102602500-102602522 AACAACCTTGACTTCAGACTTGG - Exonic
1198339430 X:135699719-135699741 GGCTATCTTGTTTACAGACTGGG - Intergenic
1199548685 X:149034645-149034667 GGCAGTGTTGTCTTAAGACTGGG - Intergenic