ID: 1067750028

View in Genome Browser
Species Human (GRCh38)
Location 10:48965340-48965362
Sequence CTGCAATCTTGTCTTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067750028_1067750030 7 Left 1067750028 10:48965340-48965362 CCAGTCTGAAGACAAGATTGCAG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1067750030 10:48965370-48965392 ACTCCATGCTGCTCCTGACAGGG No data
1067750028_1067750031 8 Left 1067750028 10:48965340-48965362 CCAGTCTGAAGACAAGATTGCAG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1067750031 10:48965371-48965393 CTCCATGCTGCTCCTGACAGGGG No data
1067750028_1067750029 6 Left 1067750028 10:48965340-48965362 CCAGTCTGAAGACAAGATTGCAG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067750028 Original CRISPR CTGCAATCTTGTCTTCAGAC TGG (reversed) Intronic
904301798 1:29558988-29559010 CTTCACTCTGGCCTTCAGACTGG + Intergenic
908752055 1:67433389-67433411 CTGAAATTTTGTATTTAGACAGG + Intergenic
909345808 1:74584940-74584962 ATGCAATTTTGTCATCAGGCAGG - Intronic
912001381 1:104839073-104839095 CTGCCTTTTTCTCTTCAGACAGG - Intergenic
913004728 1:114617693-114617715 TTTCAATCTGTTCTTCAGACTGG - Intronic
922078029 1:222267138-222267160 CCCCAATCTTCTCTTCAGAAAGG + Intergenic
923306018 1:232689150-232689172 CTGCACTCCTCTCTTCAGGCAGG + Intergenic
1062913356 10:1228887-1228909 CTTAAATCATCTCTTCAGACTGG - Intronic
1063679814 10:8176140-8176162 ATGTAATCTTACCTTCAGACTGG + Intergenic
1067750028 10:48965340-48965362 CTGCAATCTTGTCTTCAGACTGG - Intronic
1075543063 10:123331669-123331691 CTGAAATCGTGTTTTCAAACTGG + Intergenic
1075611144 10:123855670-123855692 CTGCATTCATGTCTTCATGCGGG + Intronic
1078096638 11:8301345-8301367 GTGCCATCTTGTCTTCACATAGG - Intergenic
1078526311 11:12104179-12104201 CTGTCAGCTTCTCTTCAGACTGG - Intronic
1078790062 11:14533333-14533355 GTGCCATCTTCACTTCAGACTGG + Intronic
1079731539 11:23941174-23941196 CTGCAACCGTGTCTTTAGTCTGG + Intergenic
1080867771 11:36210692-36210714 GTGCAATCCTGTCTTCTGAGAGG - Intronic
1085192272 11:74637735-74637757 TTGCACTCCTGTCTCCAGACAGG + Intronic
1085794998 11:79531202-79531224 CTGAAATATTGTATTCAGTCAGG - Intergenic
1086437329 11:86795042-86795064 CCCAAATCTTGTCTTCAGTCTGG - Intronic
1089616498 11:119697797-119697819 CTGGAATCTGGTCTTAAGAGAGG - Intronic
1091205801 11:133820155-133820177 CTCCAATCTAGTCTCCAGACAGG + Intergenic
1091310169 11:134567946-134567968 CTACAATATTTTCTTCAGACTGG + Intergenic
1091599315 12:1908450-1908472 CTGCAGCCTTGGCCTCAGACGGG + Intronic
1095642939 12:44505615-44505637 CTGCAATGGTGACTGCAGACAGG + Intergenic
1097181984 12:57177093-57177115 CTGCAATCCAGTCTACAGCCAGG - Exonic
1097520461 12:60662673-60662695 CTGAAATATTGTTTTCATACAGG - Intergenic
1101178481 12:102182996-102183018 CTGCCATTATATCTTCAGACAGG - Intronic
1101327846 12:103732372-103732394 CTGCAATCTTTTGTTCATACTGG - Intronic
1102055805 12:109895604-109895626 CTGCGGTCTTGTCTTCAGGTGGG + Intergenic
1106082454 13:26511643-26511665 CTTCAATCTGGTCTTCAAACTGG - Intergenic
1108228906 13:48318000-48318022 CTGAACTCCTGTCGTCAGACAGG + Intronic
1110339352 13:74370879-74370901 CTGCATTATTGTCTTTAGGCTGG - Intergenic
1111041017 13:82747661-82747683 CTGCTATCTTGTCTTTAAATAGG + Intergenic
1124417111 15:29481153-29481175 CTGCAGGCTCGTCTTCAGAATGG - Intronic
1124522690 15:30418200-30418222 CTGTCATCATGTCCTCAGACAGG + Intergenic
1124535974 15:30548015-30548037 CTGTCATCATGTCCTCAGACAGG - Intergenic
1124762677 15:32459579-32459601 CTGTCATCATGTCCTCAGACAGG + Intergenic
1124775948 15:32589488-32589510 CTGTCATCATGTCCTCAGACAGG - Intergenic
1125121807 15:36168754-36168776 CTGCAATTTTGTCTTGAAATGGG - Intergenic
1127506158 15:59599848-59599870 AGGCAATCTAGTCTTCAGGCAGG + Intronic
1130602167 15:85283576-85283598 CTGTAATTTTGGCTTCAGAAAGG - Intergenic
1131349599 15:91686598-91686620 CTGCATTTTTGTTTTGAGACAGG + Intergenic
1132773261 16:1576835-1576857 CTGCAATCATAACTGCAGACAGG + Intronic
1133359001 16:5158775-5158797 CTGGAATATTCTCTTCAGCCTGG + Intergenic
1136476670 16:30517823-30517845 CTGCCCTGTTGTCTTCAGGCAGG + Exonic
1136591585 16:31221040-31221062 CTACAACCTTGTGTTCAGGCAGG - Intronic
1137606912 16:49793171-49793193 CTGCACTCTTCTGTCCAGACTGG + Intronic
1140161961 16:72505729-72505751 TTGCAATTCTGTCTTCATACTGG - Intergenic
1145745358 17:27315046-27315068 CTGCAATCTTCCTTTCACACTGG - Intergenic
1146804298 17:35852953-35852975 CTGCCATCTTGTCTTCTGGTGGG + Intronic
1155207441 18:23572794-23572816 CTGCACTCTAGCCTTCAGCCAGG + Intronic
1156415924 18:36890332-36890354 CTGCCATTTTATCTTCTGACTGG - Intronic
1160185466 18:76673380-76673402 CTGACACCTTGACTTCAGACTGG - Intergenic
1162609411 19:11738055-11738077 CTGCAATCTCGCCTCCAGCCTGG - Intronic
1162612630 19:11767919-11767941 CTGCAATCTCGCCTCCAGCCTGG + Intronic
1162675223 19:12293935-12293957 CTGCAATCTCGCCTCCAGCCTGG - Intronic
1162687525 19:12400345-12400367 CTGCAATCTCGCCTCCAGCCTGG - Intronic
1162691837 19:12440187-12440209 CTGCAATCTCGCCTCCAGCCTGG - Intronic
1164283081 19:23786381-23786403 TCACAATCTTATCTTCAGACTGG - Intronic
929800531 2:45096566-45096588 CTGAAATCATGTCTTCAGATGGG + Intergenic
930356412 2:50326592-50326614 CTGCAACCTTATCTTCAGTTTGG + Intronic
937011957 2:118571077-118571099 CTGAGATCCTGTCTTGAGACAGG - Intergenic
937236699 2:120435614-120435636 CTGCATTCTTGTCTGCAGCACGG + Intergenic
937754335 2:125517226-125517248 CTGAAATCTTGTCTTCTGTTTGG - Intergenic
939914625 2:148023164-148023186 CAGCAATTTTGTGATCAGACTGG + Intronic
941135018 2:161704876-161704898 CTGCCCTATTGCCTTCAGACAGG + Intronic
942939512 2:181599592-181599614 CTGAAATCTTGTCTTCTGCTTGG - Intronic
943727671 2:191268668-191268690 CTTCATTCTTCTCTTCAGATAGG + Intronic
943818463 2:192286856-192286878 CTTCAATTTTGTTTTCAGAGAGG + Intergenic
1168931402 20:1627239-1627261 CTGGAATCTGTTCCTCAGACTGG - Intergenic
1169514148 20:6298013-6298035 CTGAAGTTTTCTCTTCAGACTGG + Intergenic
1171470676 20:25368678-25368700 TTGGAATCTTGTCTGCAAACAGG + Intronic
1172587980 20:36098131-36098153 CTGTAAGCCTGTCTTCAGCCTGG + Intronic
1173861264 20:46285157-46285179 CTGCAACCTGGTCCACAGACCGG - Intronic
1176037202 20:63045370-63045392 CTGCCATCTGGTTTTGAGACTGG + Intergenic
950048965 3:9971515-9971537 CAGCAACATTGTATTCAGACAGG - Intronic
951530323 3:23692921-23692943 TTGCAATCTTGGCTGCACACTGG + Intergenic
953363603 3:42322665-42322687 CTGCAATCTTGTTTTCTTCCAGG - Intergenic
957064251 3:75508291-75508313 CTGGAATATTCTCTTCAGCCTGG + Intergenic
957142142 3:76374112-76374134 ATACAAGTTTGTCTTCAGACTGG - Intronic
961289105 3:125831093-125831115 CTGGAATATTCTCTTCAGCCTGG - Intergenic
965448261 3:168803203-168803225 ATGTAATGTTGTCTTCTGACAGG - Intergenic
969008108 4:4038040-4038062 CTGGAATATTCTCTTCAGCCTGG + Intergenic
969097864 4:4747664-4747686 CTGCATTCTTGGCTCCAGAAAGG + Intergenic
969804814 4:9599000-9599022 CTGGAATATTCTCTTCAGCCTGG - Intergenic
970755826 4:19425037-19425059 GTACAATCTTGTGTTCAGCCAGG - Intergenic
970866385 4:20763599-20763621 CTGCATTCTTGTCTTCTTTCTGG - Intronic
972451202 4:39200407-39200429 CTGCAATCGTGTTGTCAGACAGG + Intronic
972674408 4:41245582-41245604 CTGCACTCCTGTCTTCGGCCTGG - Intergenic
972840948 4:42929433-42929455 CAGAAATCTTGTCATCAGGCAGG + Intronic
972942562 4:44214780-44214802 AGGCAGTCTTGTCTTCAGGCAGG - Intronic
973060270 4:45715617-45715639 CCGCAATCTAGTCTGCAAACTGG - Intergenic
975375588 4:73640449-73640471 CTGCAAACTTTTCTTCATAGTGG + Intergenic
977878922 4:102181984-102182006 CTGGAATCTTGTTTTCTGACTGG - Intergenic
979150990 4:117313888-117313910 CTGCAATATTGTCCTCTTACTGG - Intergenic
982557454 4:156885844-156885866 CTGCACTCTAGTCTGCAGACTGG + Intronic
983388316 4:167094972-167094994 CTTCAAACTTGGATTCAGACTGG - Intronic
984559777 4:181254707-181254729 CACCAATCTTGTGTTCTGACTGG + Intergenic
989005525 5:36807207-36807229 CTGGAATCTTCTCTGTAGACAGG + Intergenic
989293645 5:39797779-39797801 CTGCAGGCTAGTCTTCAGAACGG - Intergenic
990607441 5:57424361-57424383 CTGCAATCTTGTTTTCTTCCAGG - Intergenic
993750565 5:91661194-91661216 ATGCAATCTGGACTTCAGATAGG - Intergenic
995880474 5:116839514-116839536 CTGCAATTTTTTGTACAGACAGG - Intergenic
997717272 5:136051694-136051716 CTGGAAACTAGTCTTCAAACTGG - Intronic
999005891 5:147978520-147978542 CTGCTGTCTTGGCTTCAGCCTGG - Intergenic
1000616510 5:163433519-163433541 CTGCAGTGTTGGCTTCTGACTGG + Intergenic
1001159164 5:169299397-169299419 CTGCTTTCTTGACTTCAGGCTGG - Intronic
1003311100 6:4970632-4970654 CTGCAATCTCGTCCTGTGACAGG + Intergenic
1014238434 6:118988118-118988140 CTGTAATCTTTTCTTCATAGCGG - Intronic
1017901975 6:158726232-158726254 CTGAAATTTTGTCTTTGGACAGG - Intronic
1017977908 6:159374530-159374552 CTGCAATCTGGTTATCAGCCAGG + Intergenic
1018982182 6:168609862-168609884 CTGCACTGTGGTCTTCACACAGG + Intronic
1020328630 7:6996170-6996192 CTGGAATATTCTCTTCAGCCTGG + Intergenic
1020384787 7:7588494-7588516 CTGCAACTTTGTTTTCATACTGG - Exonic
1021617394 7:22517129-22517151 TTGCAAAATTGCCTTCAGACAGG + Intronic
1022926981 7:35066543-35066565 TTGCAAAATTGCCTTCAGACAGG + Intergenic
1023359382 7:39400018-39400040 CAGCAATCATGTCTTCATAATGG - Intronic
1024374641 7:48623034-48623056 CTGCAAGCTTGGAGTCAGACTGG - Intronic
1025262610 7:57429898-57429920 CTGAAACATTGTCTTCAGATTGG - Intergenic
1025740004 7:64187425-64187447 CTGAAATGTTGTCTTCAGATTGG - Intronic
1026617532 7:71919163-71919185 CAGGCATCTTATCTTCAGACTGG + Intronic
1027563648 7:79763782-79763804 ATGCAGTCTAGTCTTTAGACTGG - Intergenic
1028375281 7:90138980-90139002 TTGCAAAATTGCCTTCAGACAGG - Intergenic
1029248648 7:99220521-99220543 TTTAAATCTTGTTTTCAGACAGG + Intergenic
1029401494 7:100349810-100349832 CTGCAACATGGTCTTCAGTCAGG - Intronic
1032085631 7:128882014-128882036 CTGGATTCTTGTCTTCACAGAGG - Exonic
1033823132 7:145157778-145157800 CTTGTATCTTGACTTCAGACTGG - Intergenic
1037446956 8:18974820-18974842 CTGCAGTCTTGACTACAGCCTGG + Intronic
1039866372 8:41507342-41507364 CTGCTGTATTGTGTTCAGACTGG + Intronic
1041539394 8:58966111-58966133 CTGACATCTTCTCTTGAGACTGG - Intronic
1042282928 8:67074482-67074504 CTGCAATCTTGTCTGGAGTCAGG - Intronic
1044420725 8:91993032-91993054 CAGCACTCTTATCTTTAGACAGG + Intronic
1048043124 8:130749818-130749840 CTGCCATCTTCTGGTCAGACTGG - Intergenic
1048538130 8:135316655-135316677 CTGCCAGCTTGTCATCAGGCAGG - Intergenic
1050853045 9:10313109-10313131 TTCCAATCTGGTCTTCAGAAAGG - Intronic
1052631596 9:31048319-31048341 CTGCAATGGTGGCTTAAGACAGG - Intergenic
1057392875 9:94653919-94653941 CTGCCATCTTGGCTCCTGACAGG - Intergenic
1058885127 9:109317181-109317203 CTGCAATTGTTTCTTCTGACAGG - Intronic
1185513842 X:683589-683611 CTGCAATCCAGTCTCCACACTGG - Intergenic
1190876066 X:54461151-54461173 CTGCAATTTTATTTTCACACTGG - Intronic
1199659798 X:150037687-150037709 CTTCAATCTTGTCTAGAAACTGG + Intergenic
1201723511 Y:17130355-17130377 CTGCAAACTTGTCTTTTGTCAGG + Intergenic