ID: 1067750029

View in Genome Browser
Species Human (GRCh38)
Location 10:48965369-48965391
Sequence GACTCCATGCTGCTCCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067750026_1067750029 15 Left 1067750026 10:48965331-48965353 CCAAGTGTCCCAGTCTGAAGACA 0: 1
1: 0
2: 2
3: 17
4: 146
Right 1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG No data
1067750028_1067750029 6 Left 1067750028 10:48965340-48965362 CCAGTCTGAAGACAAGATTGCAG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG No data
1067750025_1067750029 16 Left 1067750025 10:48965330-48965352 CCCAAGTGTCCCAGTCTGAAGAC 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG No data
1067750027_1067750029 7 Left 1067750027 10:48965339-48965361 CCCAGTCTGAAGACAAGATTGCA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG No data
1067750024_1067750029 17 Left 1067750024 10:48965329-48965351 CCCCAAGTGTCCCAGTCTGAAGA 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1067750029 10:48965369-48965391 GACTCCATGCTGCTCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067750029 Original CRISPR GACTCCATGCTGCTCCTGAC AGG Intronic
No off target data available for this crispr