ID: 1067752312

View in Genome Browser
Species Human (GRCh38)
Location 10:48979689-48979711
Sequence CACTGCCAGAATCAACTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067752312_1067752318 19 Left 1067752312 10:48979689-48979711 CCATTCAGTTGATTCTGGCAGTG 0: 1
1: 0
2: 5
3: 32
4: 243
Right 1067752318 10:48979731-48979753 CTATTCAGCATCAATGGTTGTGG No data
1067752312_1067752319 24 Left 1067752312 10:48979689-48979711 CCATTCAGTTGATTCTGGCAGTG 0: 1
1: 0
2: 5
3: 32
4: 243
Right 1067752319 10:48979736-48979758 CAGCATCAATGGTTGTGGTGAGG No data
1067752312_1067752316 13 Left 1067752312 10:48979689-48979711 CCATTCAGTTGATTCTGGCAGTG 0: 1
1: 0
2: 5
3: 32
4: 243
Right 1067752316 10:48979725-48979747 AGGTTCCTATTCAGCATCAATGG No data
1067752312_1067752314 -7 Left 1067752312 10:48979689-48979711 CCATTCAGTTGATTCTGGCAGTG 0: 1
1: 0
2: 5
3: 32
4: 243
Right 1067752314 10:48979705-48979727 GGCAGTGCCATTGGATTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067752312 Original CRISPR CACTGCCAGAATCAACTGAA TGG (reversed) Intronic
900818565 1:4869239-4869261 CACTGCCAGGATCACCCGAGTGG - Intergenic
901002712 1:6156616-6156638 CACTGCCAGTTTCCAGTGAAAGG + Intronic
902267990 1:15282136-15282158 CAGCCCCAGAATCAGCTGAAGGG + Intronic
902886706 1:19410335-19410357 CACTGCAAGAACCAACGGGATGG - Intronic
907452132 1:54552197-54552219 CACTGTCAGGATCAACTTCATGG - Intronic
907559450 1:55375297-55375319 CACTGCCAGCAAAAACAGAAAGG + Intergenic
908726102 1:67178728-67178750 CACAGCCAATATCATCTGAATGG - Intronic
908899679 1:68942208-68942230 CACTGCCAGCTTGAACTGAAAGG + Intergenic
910336117 1:86133460-86133482 CACAGCCAATATCTACTGAATGG - Intronic
914230051 1:145757456-145757478 CACTGCCAGCTTAAACTGAAAGG + Intronic
915167051 1:153953804-153953826 CTCTGCCAGGACCAGCTGAATGG + Intronic
916847644 1:168669747-168669769 CACTGCCAGCTTGGACTGAAAGG + Intergenic
918502558 1:185214300-185214322 GAATACCAGAATCAACTCAAAGG + Intronic
921511376 1:216034728-216034750 GACTGCCAGAAACCACTGGAGGG + Intronic
922119707 1:222652735-222652757 CACTTCCAGAAGGAACAGAAGGG - Intronic
922303408 1:224323528-224323550 CACTGCCAGCTTGGACTGAAGGG + Intronic
923324474 1:232869123-232869145 CACTGCCAGAAACCACGGGAAGG - Intergenic
923334463 1:232955258-232955280 CAATCCCAGAATCAACTGAGAGG - Intronic
923626180 1:235615805-235615827 CACTGCCACAGTGAACTGGATGG + Intronic
923793227 1:237128674-237128696 GGCTGCCAGAATAGACTGAATGG + Intronic
924797674 1:247304043-247304065 CACTGCCAGCTGGAACTGAAAGG + Intronic
1063231259 10:4067690-4067712 CACTTCTAGAATCCACTCAAGGG + Intergenic
1063731725 10:8705206-8705228 CCCTGTCAGAAACAAATGAATGG + Intergenic
1064358609 10:14642533-14642555 CACTGCCAGTTTGAACCGAAGGG - Intronic
1064998775 10:21318716-21318738 CAGGGCCAGAGTGAACTGAACGG - Intergenic
1065931688 10:30485071-30485093 CATTGCCAGAAGAAACTCAAAGG + Intergenic
1067278782 10:44855785-44855807 CAATGGCAAAATCAACTCAATGG - Intergenic
1067710574 10:48648358-48648380 CACTGCCCCAATCAACTGCAAGG - Intronic
1067752312 10:48979689-48979711 CACTGCCAGAATCAACTGAATGG - Intronic
1067776203 10:49166565-49166587 GACTGCCAAGAGCAACTGAAAGG + Intronic
1070726152 10:78792431-78792453 CACTGCCAGAAACAACAGGACGG - Intergenic
1072058214 10:91781950-91781972 CACTGCCAGCCTGGACTGAAAGG - Intergenic
1073593534 10:104778608-104778630 CACTACCAGACTCATCTGACAGG - Intronic
1073718918 10:106142695-106142717 CAAGGGCAGAGTCAACTGAATGG - Intergenic
1076275775 10:129197178-129197200 CGCTGACAGAATCAACAGCAAGG - Intergenic
1076463157 10:130660144-130660166 CACTGCAAGATTCAAAGGAAGGG + Intergenic
1077935894 11:6785330-6785352 CAGTGCCAGGAACATCTGAAGGG - Exonic
1081108947 11:39107571-39107593 CACTGCCAACATGGACTGAAGGG - Intergenic
1081142070 11:39513809-39513831 CACTGCCAATTTGAACTGAAAGG + Intergenic
1082320552 11:50802227-50802249 CACTTGCAGATTCTACTGAAAGG - Intergenic
1082325130 11:51130849-51130871 CACTTGCAGAATCCACGGAAAGG - Intergenic
1082333663 11:51254617-51254639 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082347278 11:51452693-51452715 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082349330 11:51482441-51482463 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082375342 11:51860582-51860604 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082394743 11:52143083-52143105 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082397262 11:52179634-52179656 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082399320 11:52209381-52209403 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082399918 11:52217883-52217905 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082425145 11:52582575-52582597 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082425612 11:52589374-52589396 CACTGGCAGAATCCAAAGAAAGG - Intergenic
1082453997 11:52999913-52999935 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082455098 11:53016061-53016083 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082458011 11:53058571-53058593 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082483648 11:53428600-53428622 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082486183 11:53465133-53465155 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082501600 11:53687124-53687146 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082516757 11:53906483-53906505 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082516870 11:53908182-53908204 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082517281 11:53914134-53914156 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082526693 11:54050331-54050353 CACTTGCAGAATCAAAAGAAAGG - Intergenic
1082931153 11:58606855-58606877 CACTGTCAGAATCAACTTTGTGG - Intronic
1084901941 11:72316189-72316211 GAGTGTCAGAATCACCTGAAGGG + Intronic
1085133561 11:74063656-74063678 CACAGCCAATATCATCTGAATGG + Intronic
1086839804 11:91671117-91671139 CACAGCCAACATCAACTGAATGG + Intergenic
1087247840 11:95860621-95860643 CACTGGCAGAATAAAAAGAAAGG + Intronic
1087970673 11:104478016-104478038 CACTGCCAGAATCAACTATTTGG + Intergenic
1089571065 11:119410159-119410181 CCATGCCAGATTCAACAGAAGGG + Intergenic
1095139094 12:38640489-38640511 CACTGCCAGGGTCATCAGAAAGG + Intergenic
1095317749 12:40786356-40786378 CACTGCCAGATTAGACTGAAAGG - Intronic
1096150313 12:49305754-49305776 CACTGCCAGCTTGTACTGAAAGG - Intergenic
1099298243 12:80858011-80858033 CAAAGCCAGAATCAAATAAAAGG - Intronic
1099351904 12:81581851-81581873 AACTGCAAGCCTCAACTGAATGG + Intronic
1099605387 12:84796480-84796502 CACTGCCAGGGTCATCAGAAAGG + Intergenic
1099986446 12:89671009-89671031 AACTGCTAGGATCATCTGAAAGG + Intronic
1101442464 12:104713920-104713942 CACTGCCAGAATGAAAATAAAGG - Intronic
1101829686 12:108247916-108247938 CACTGCCAGCACCATCTGACTGG + Intronic
1102484915 12:113249014-113249036 CTCTCCCACAATCAGCTGAAAGG - Intronic
1103803463 12:123554848-123554870 CACTGCCAGGGTCATCAGAAAGG + Intergenic
1104150845 12:126081486-126081508 CACAGCCAGTATCCTCTGAATGG + Intergenic
1104744961 12:131204739-131204761 CACTGCCAAAATCAGGTCAAAGG + Intergenic
1104789444 12:131472661-131472683 CACTGCCAAAATCAGGTCAAAGG - Intergenic
1107146200 13:37062678-37062700 CACTGCCTGTTTCAACTGAAGGG - Intergenic
1107963921 13:45582299-45582321 CACAACCAGATACAACTGAAAGG - Intronic
1108103922 13:46988366-46988388 CACAGCAAGAATTAAATGAAGGG - Intergenic
1109091244 13:58048897-58048919 GAAAGCCAGAATCAACTTAAGGG + Intergenic
1113254236 13:108489229-108489251 CACAGCTAGTATCCACTGAATGG + Intergenic
1114670626 14:24408990-24409012 CCCTGGCAGCTTCAACTGAATGG - Exonic
1115677819 14:35699966-35699988 CACTTCCAGAATGAACTGCAAGG + Intronic
1116949746 14:50868309-50868331 CACTTCCAGTTTCAACTGAAAGG + Intronic
1117500806 14:56349226-56349248 CACTACCAGATTACACTGAAAGG - Intergenic
1118067827 14:62211206-62211228 CACTGCCAGTTTTAACTGAAGGG - Intergenic
1118168286 14:63359530-63359552 CACTGCCAAATTGGACTGAAAGG + Intergenic
1121505552 14:94474182-94474204 CACTGCCAGCCTCCACAGAAAGG - Intronic
1126407456 15:48335739-48335761 GACTGCTAGAATGAGCTGAAAGG - Intronic
1126814544 15:52441953-52441975 CACTCCCAAAATCTTCTGAAAGG + Intronic
1127189196 15:56511636-56511658 CACAGCCAACATCTACTGAATGG - Intergenic
1127623017 15:60752481-60752503 AACTGCCAGAAATAACAGAAGGG - Intronic
1127999125 15:64174583-64174605 CAGTCAAAGAATCAACTGAAAGG - Intronic
1129759801 15:78122838-78122860 CACTGCCTGAATGAGCAGAATGG + Intronic
1131535348 15:93232646-93232668 CTCTGCTAGAATCAAATAAAAGG + Intergenic
1133400665 16:5484277-5484299 GACAGCCAGAAAGAACTGAAGGG - Intergenic
1134682606 16:16136886-16136908 GACAGCCACTATCAACTGAATGG - Intronic
1136384573 16:29915248-29915270 CACTGCCAGCTTGGACTGAAAGG - Intronic
1139735430 16:68983654-68983676 CACTGCCACACTCAACTGCAGGG - Intronic
1140063486 16:71590748-71590770 CACTTCCAGAATCTGCAGAAGGG + Intergenic
1143011717 17:3869658-3869680 CATTACCAGAATCACCTGGAGGG + Intronic
1143964282 17:10745605-10745627 CAGTGCCACAATCATCTGAAGGG + Intergenic
1145211075 17:21013427-21013449 CACTTCCAGATGCAACTGACTGG - Intronic
1148102197 17:45099115-45099137 CACTCCTAGAATCAAGTCAACGG - Intronic
1156228874 18:35135007-35135029 CTCTGCCAGATTCAACTGCCTGG - Intronic
1156417565 18:36913180-36913202 CACTGCCAGTTTAAATTGAAAGG - Intronic
1156933919 18:42679454-42679476 CAATGCCAGGAGGAACTGAAAGG + Intergenic
1157045596 18:44099181-44099203 AACTTCCAGAAACAACTGAGAGG - Intergenic
1157537865 18:48473784-48473806 CACTGCCAGTTTGAACTAAAGGG + Intergenic
1157976610 18:52334931-52334953 CACTGCCAGATTGGACTCAAAGG - Intergenic
1158492618 18:57923858-57923880 CACTGCCAAAATCCACAGAGAGG - Intergenic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1158786023 18:60712664-60712686 CACTGCCAGGGTCATCAGAAAGG + Intergenic
1159056668 18:63472585-63472607 CACTCCCAGGAACAAATGAAAGG - Intergenic
1166408976 19:42543619-42543641 CACTCCCAGTGTCCACTGAATGG + Intronic
925173109 2:1763948-1763970 CACAGCCAATATCAACTGAATGG + Intergenic
925228009 2:2203153-2203175 CACAGCCAATATCAACTGAATGG + Intronic
925381897 2:3434050-3434072 CACTGAGAGAATCAGCTTAAAGG + Intronic
925797348 2:7560917-7560939 CACAGCAATAATTAACTGAATGG + Intergenic
926619292 2:15032761-15032783 AACTGCCAGTTCCAACTGAAAGG + Intergenic
926827196 2:16917762-16917784 CAAAGACAGAATAAACTGAATGG + Intergenic
928106998 2:28476985-28477007 AACTGGCAGAAGCAACTGAGAGG + Intronic
930497391 2:52163737-52163759 CACTGCTAGATTCCACAGAAAGG + Intergenic
932837216 2:75049137-75049159 CACTTCCAGAATGGAATGAATGG + Exonic
932918021 2:75878003-75878025 CACTGCCAGGGTCATCAGAAAGG + Intergenic
937861301 2:126713135-126713157 CACTACCAGAATAAACCCAATGG - Intergenic
939728694 2:145754827-145754849 CACTTCCAGCATCACCTGCAGGG + Intergenic
939835068 2:147119895-147119917 CACTGCCAGCATGGACTAAAAGG - Intergenic
939841683 2:147196947-147196969 CCTTGCTAGAATCAACAGAAAGG + Intergenic
940302516 2:152190100-152190122 CACTCCCAGAATCGACTGAACGG + Intergenic
940811066 2:158243397-158243419 CACTGCCAGCTTGGACTGAAAGG - Intronic
941775743 2:169391540-169391562 CAGTGCCAGAATCTATTCAATGG + Intergenic
943641665 2:190365676-190365698 GACTGCCAGAATCACCTGGTGGG - Intronic
945922316 2:215768064-215768086 CACTGCCAGTTTGAACTGAAAGG + Intergenic
946544572 2:220723909-220723931 GACTTCCAGTACCAACTGAATGG + Intergenic
946646646 2:221844529-221844551 CACTGCCAGTTTGGACTGAAAGG - Intergenic
1171426508 20:25051909-25051931 CACAGCCAGAAACAACCCAATGG - Intronic
1171565529 20:26181772-26181794 CACTGCCAGTTTGAACTGACGGG - Intergenic
1172488132 20:35311996-35312018 CTCTGCCAGAATGGACTGGATGG + Intronic
1173385859 20:42587347-42587369 CTCTGCCAGAATCCACCGAAAGG + Intronic
1178921156 21:36739179-36739201 CACTGGCAGACACAGCTGAAGGG - Intronic
1180261255 21:46670683-46670705 TACAGCCAGAATCAATTGATAGG + Intergenic
1181929086 22:26384925-26384947 CACTGCCAGTTTGAACTAAAGGG - Intergenic
1182530223 22:30949828-30949850 CACTGGCAGCATCACCTGAAAGG + Exonic
1184478058 22:44732071-44732093 CACTGCCAGAGGAAACTGAAGGG + Intronic
949093817 3:62081-62103 CACTGCCAGACTGGCCTGAAAGG + Intergenic
949326175 3:2867249-2867271 CACAGTCAGAATGAAGTGAAAGG + Intronic
949849315 3:8406534-8406556 AACAGCCAGATTGAACTGAAAGG + Intergenic
949995653 3:9614469-9614491 CAATGGCACAACCAACTGAAAGG - Intergenic
950657637 3:14446792-14446814 CACAGTCAGCATCAAATGAATGG + Intronic
952921870 3:38290891-38290913 CACTGCCAGGGTCATCAGAAAGG - Intronic
953544799 3:43856580-43856602 GACTGCCAGAAGCACCTGCAGGG + Intergenic
955958644 3:64316615-64316637 CAGTGTCAGAATTAACTGGAAGG + Intronic
955987625 3:64591110-64591132 GACTGCAGGAGTCAACTGAAAGG + Intronic
956715668 3:72077717-72077739 CACTGCCAGCTTGACCTGAAAGG - Intergenic
957696219 3:83640892-83640914 CAGAGCCAATATCAACTGAATGG + Intergenic
959597708 3:108146090-108146112 TAGTGCTAGAGTCAACTGAAAGG - Intergenic
960184257 3:114619069-114619091 TCCTGCCAGAATGAACTGGAAGG + Intronic
961991623 3:131197908-131197930 CACTGCCATCATCATCAGAAAGG - Intronic
962187834 3:133278988-133279010 CACCTCAAGAATCAACTCAAGGG - Intronic
962272470 3:133988056-133988078 CACTGCCCCAAGCATCTGAATGG + Intronic
963103585 3:141626708-141626730 CACCGTCAGAATCACCTGGAAGG - Intergenic
963338863 3:144009447-144009469 GAATGCCAGATCCAACTGAAGGG + Intronic
964208669 3:154203592-154203614 CATAGCTAGTATCAACTGAATGG - Intronic
964581507 3:158244231-158244253 TATTGCCAATATCAACTGAATGG - Intronic
964948381 3:162255381-162255403 CACTGCCAGCTTCAACTGAAAGG - Intergenic
965313906 3:167166710-167166732 CACTGCCAAAATAAAAAGAATGG - Intergenic
965418359 3:168425877-168425899 CACTGCCAGTTTCAAGTGATGGG + Intergenic
966774313 3:183530722-183530744 CACTGCCAGTTTGAACTGAAGGG + Intronic
971585286 4:28398171-28398193 AACTCACAGGATCAACTGAAAGG - Intronic
973935844 4:55845762-55845784 CACAGCCAATATCTACTGAATGG + Intergenic
975036659 4:69692839-69692861 CACAGCCAACCTCAACTGAATGG - Intergenic
975907938 4:79237566-79237588 CACTGTCAAAATGAAGTGAAAGG - Intronic
976464599 4:85353164-85353186 CACTGCCAGGGTCATCAGAAAGG - Intergenic
977516597 4:98027898-98027920 CACTGCCAGCTTGGACTGAAAGG - Intronic
978347786 4:107789199-107789221 CACTGCCACCATCACCTGCATGG + Intergenic
979231697 4:118353947-118353969 CATAGTCAGAAACAACTGAAAGG - Intergenic
979751961 4:124290142-124290164 CACTGCCAGAATCATGGCAAGGG - Intergenic
981698660 4:147584116-147584138 CACTGCCAGTTTGAACTGAAGGG - Intergenic
981777832 4:148390495-148390517 TAGTTCCAGAATCACCTGAAAGG + Intronic
982126002 4:152184474-152184496 CACAACCAGAATCATGTGAATGG + Intergenic
983302725 4:165947880-165947902 CACTGCCAGCATGGACAGAAAGG + Intronic
983487894 4:168353313-168353335 CACTGCCTGAATTAAGTGAGGGG - Intergenic
983499503 4:168482983-168483005 CACTGCCAGCTTGAACTGAAAGG + Intronic
984058935 4:174966917-174966939 CACTACCAGTTTGAACTGAAAGG - Intronic
985255388 4:188064915-188064937 CACTGCCACCATTAACTGGAGGG - Intergenic
987279380 5:16397086-16397108 CACAGCCAATATCATCTGAATGG - Intergenic
987423112 5:17744194-17744216 AAGTGCCAGAATCAACATAAAGG - Intergenic
987716287 5:21576747-21576769 CACCACGAGAATGAACTGAATGG - Intergenic
991250019 5:64549654-64549676 CACTGCCAGTTTGAACAGAAGGG - Intronic
991445365 5:66694307-66694329 GGCTGCCAGAAACCACTGAAAGG - Intronic
992031143 5:72722731-72722753 CACAGCCACCATCAACAGAATGG - Intergenic
992232788 5:74680118-74680140 CACTGCCAGCATGAACTGAAAGG + Intronic
992480391 5:77145741-77145763 CACTGCCAACTTAAACTGAAAGG + Intergenic
994360203 5:98841412-98841434 CAAAGCAAGAATAAACTGAATGG - Intergenic
994644413 5:102450998-102451020 CAGAGCCATCATCAACTGAAGGG + Intronic
995178807 5:109210604-109210626 CACAGCCAATATCTACTGAATGG - Intergenic
995465992 5:112449990-112450012 CACTGCCAGGGTCATCAGAAAGG + Intergenic
996481462 5:123980274-123980296 CATTGCTAGTTTCAACTGAAAGG + Intergenic
998111874 5:139508696-139508718 CACTGCCAAAACCATCAGAAAGG + Intergenic
998323008 5:141250296-141250318 CACTGCCAGCTTGAATTGAAAGG + Intergenic
999463015 5:151772636-151772658 CACTGCAAGAATCAAATGAAAGG - Intronic
1000506505 5:162126670-162126692 GACTGCCAGAATTAGGTGAAGGG - Intronic
1002667075 5:180832853-180832875 AAGTGTCAGAATCACCTGAAGGG - Intergenic
1002820321 6:718724-718746 CACTGGCACACTCACCTGAATGG + Intergenic
1004815039 6:19303637-19303659 TACTTTCAGAACCAACTGAAGGG + Intergenic
1005245592 6:23880941-23880963 CATTGGCAGACTCAACTGAAAGG + Intergenic
1005262397 6:24075367-24075389 CACGGCCAACATCTACTGAATGG - Intergenic
1005323307 6:24676785-24676807 CACTGCCAGAGTCACCAGAAAGG - Intronic
1007360080 6:41348738-41348760 CACTGCCAGATTGGACTGAAAGG - Intronic
1007450452 6:41937882-41937904 CACTTCTTGAATCAACAGAAGGG + Intronic
1007628089 6:43257804-43257826 CACTGACATGATCAACTGCAGGG - Exonic
1008605385 6:53134455-53134477 CACTGTCAGAATTAAATGTAGGG - Intronic
1008723564 6:54389010-54389032 TCCTGCTAGAATCAACTCAATGG + Intronic
1009896933 6:69763421-69763443 CACTGCCAGTTTGAACTGAAGGG + Intronic
1010554183 6:77258531-77258553 CACTGCCAGTTTGGACTGAAGGG - Intergenic
1010920114 6:81670665-81670687 TGCTGCCACTATCAACTGAAGGG - Intronic
1014873358 6:126624570-126624592 CACTGGCACAATTAAGTGAAAGG + Intergenic
1016353953 6:143197567-143197589 CATGGCCAGAACCAACTGCAGGG - Intronic
1016444352 6:144117364-144117386 CACTGCCAGGGTCATCAGAAAGG - Intergenic
1016676608 6:146777630-146777652 CTGTGTCAGAATCACCTGAAGGG - Intronic
1017317731 6:153051902-153051924 AACTGCCAGTTTGAACTGAATGG + Intronic
1018156321 6:160988626-160988648 CACTTCCAGAAGGAAATGAAGGG + Intergenic
1020362939 7:7349387-7349409 CAGTAACAGAACCAACTGAAAGG - Intergenic
1023024813 7:36040899-36040921 CACTGGAAGAATAAAATGAAGGG + Intergenic
1023513921 7:40981361-40981383 CACTGCCAGTGTGAACTAAAGGG - Intergenic
1023762974 7:43483938-43483960 CACTGCCACAATCAGATGGAAGG + Intronic
1025876654 7:65486608-65486630 AACTGGCAGAATCAACAGAAAGG + Intergenic
1027649734 7:80851649-80851671 GAGTGCCAGAATCAGCTGAGAGG + Intronic
1029218584 7:98970104-98970126 CACGGCCAGAAGCAGCTGCAAGG - Exonic
1029481672 7:100817191-100817213 CACAGCCAGACCCAACTGGATGG - Exonic
1030166072 7:106556578-106556600 CACAGCCAATATCATCTGAATGG - Intergenic
1031140120 7:117933091-117933113 CCCTGCCAGCACCGACTGAAGGG - Intergenic
1033873393 7:145784923-145784945 CACTGCAAGAATCCAATCAAGGG + Intergenic
1036836688 8:12076447-12076469 CAATGCCAGAAGAAACAGAATGG + Intergenic
1036858531 8:12323015-12323037 CAATGCCAGAAGAAACAGAATGG + Intergenic
1038865842 8:31438090-31438112 CACTTCCAAAATCATCTGAATGG - Intergenic
1039285808 8:36039698-36039720 CACTGCCAGCTTGAACAGAAGGG + Intergenic
1039626582 8:39060506-39060528 CACTCCCACAACCAACAGAATGG - Intronic
1039686392 8:39806850-39806872 CACTGCCTGTTTTAACTGAAAGG + Intronic
1040127254 8:43751981-43752003 AGCTGCCAGAATCAAAAGAAAGG - Intergenic
1041296094 8:56358889-56358911 TGCTCCCAGAAGCAACTGAAAGG - Intergenic
1041501080 8:58539501-58539523 CCCTGCCAGAGTCAAAGGAACGG + Intergenic
1041867762 8:62596389-62596411 CACTGCCAGGGTCACCAGAAAGG - Intronic
1041998468 8:64092044-64092066 CACTGCCAGTTTGAACTAAAGGG + Intergenic
1042056245 8:64767307-64767329 CACTGCCAGGTTCATCGGAAAGG + Intronic
1042364623 8:67922576-67922598 CACTGCCAGGGTCATCAGAAAGG + Intergenic
1044370077 8:91399867-91399889 CACTGCCAGTTTGAACTGAAGGG - Intergenic
1044760532 8:95513195-95513217 CACTGCCAAAAGCAATTAAAAGG - Intergenic
1044972681 8:97635088-97635110 CACTGCCAGTTTGGACTGAAAGG - Intergenic
1047898352 8:129392194-129392216 CACAGCCAGAATCTACTCATAGG - Intergenic
1048690149 8:136953929-136953951 CACAGCCTTAATTAACTGAAGGG + Intergenic
1051725389 9:20083573-20083595 CACTGGCAGACTTGACTGAATGG - Intergenic
1052139535 9:24962120-24962142 CACTGCCAATATCAGCAGAATGG + Intergenic
1053461968 9:38278222-38278244 CACTGCCAGAGCCAACAAAAGGG - Intergenic
1055108747 9:72539005-72539027 AACTCCCCCAATCAACTGAATGG - Intronic
1055373012 9:75620462-75620484 CACAGCCAACATCAACTGAATGG - Intergenic
1055833817 9:80415548-80415570 CACAGCCAACATCTACTGAATGG - Intergenic
1056704570 9:88941049-88941071 CACTGCCAGGGTCATCAGAAAGG - Intergenic
1058513239 9:105742081-105742103 CACTGCCAGCTTGGACTGAAAGG + Intronic
1061485055 9:130916299-130916321 CACTGGCAAAATCAACTGAATGG - Intronic
1189890429 X:45596122-45596144 TTTTGTCAGAATCAACTGAAGGG - Intergenic
1190427469 X:50346373-50346395 CAGTGCCAGAAGCAACATAATGG - Intronic
1191205179 X:57826059-57826081 CACAGCCAACATCAACTGAATGG - Intergenic
1191816828 X:65254211-65254233 CACTGCTGGAAACACCTGAATGG + Intergenic
1194724075 X:97374095-97374117 CACTGCCAGAAAAAAAAGAAGGG + Intronic
1195356507 X:104044374-104044396 CATTGCCAGACTGGACTGAACGG - Intergenic
1195655903 X:107331431-107331453 TATTCACAGAATCAACTGAAAGG - Intergenic
1197033496 X:121847521-121847543 CACTGCCAGCTTGGACTGAAGGG + Intergenic
1200851402 Y:7887522-7887544 CACTGCCAGGGTCATCAGAAAGG - Intergenic
1202243238 Y:22791524-22791546 CACTGCCAAAACCATCAGAAAGG + Intergenic
1202350951 Y:23990715-23990737 CAAAGCCAGAATCAAAAGAAAGG + Intergenic
1202396225 Y:24425274-24425296 CACTGCCAAAACCATCAGAAAGG + Intergenic
1202474559 Y:25244818-25244840 CACTGCCAAAACCATCAGAAAGG - Intergenic
1202519828 Y:25679404-25679426 CAAAGCCAGAATCAAAAGAAAGG - Intergenic