ID: 1067758507

View in Genome Browser
Species Human (GRCh38)
Location 10:49025491-49025513
Sequence CTGGGGATGGGAGGTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1062
Summary {0: 1, 1: 1, 2: 6, 3: 117, 4: 937}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067758507_1067758518 6 Left 1067758507 10:49025491-49025513 CCACACACACCTCCCATCCCCAG 0: 1
1: 1
2: 6
3: 117
4: 937
Right 1067758518 10:49025520-49025542 GGCCCGCCATGGCCAGGCCTCGG No data
1067758507_1067758524 19 Left 1067758507 10:49025491-49025513 CCACACACACCTCCCATCCCCAG 0: 1
1: 1
2: 6
3: 117
4: 937
Right 1067758524 10:49025533-49025555 CAGGCCTCGGCCTTGACCCTGGG No data
1067758507_1067758523 18 Left 1067758507 10:49025491-49025513 CCACACACACCTCCCATCCCCAG 0: 1
1: 1
2: 6
3: 117
4: 937
Right 1067758523 10:49025532-49025554 CCAGGCCTCGGCCTTGACCCTGG No data
1067758507_1067758516 0 Left 1067758507 10:49025491-49025513 CCACACACACCTCCCATCCCCAG 0: 1
1: 1
2: 6
3: 117
4: 937
Right 1067758516 10:49025514-49025536 CTGCCTGGCCCGCCATGGCCAGG No data
1067758507_1067758514 -5 Left 1067758507 10:49025491-49025513 CCACACACACCTCCCATCCCCAG 0: 1
1: 1
2: 6
3: 117
4: 937
Right 1067758514 10:49025509-49025531 CCCAGCTGCCTGGCCCGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067758507 Original CRISPR CTGGGGATGGGAGGTGTGTG TGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900122765 1:1055962-1055984 GTGGGGATGGGATGGGGGTGGGG - Exonic
900135284 1:1114602-1114624 CTGGGGGCGGGATGTGTGTCAGG + Intronic
900291471 1:1925475-1925497 CAGGGGGTGGGTGGTGGGTGGGG + Intronic
900354521 1:2253830-2253852 CAGCAGAGGGGAGGTGTGTGCGG + Intronic
900388043 1:2419548-2419570 CTGGGGATGTGAGGCCGGTGAGG + Intergenic
900401909 1:2476177-2476199 CTGGGGATGGGAGGGCACTGGGG - Intronic
900432399 1:2609114-2609136 CTGGGGTTGGGGTGTGAGTGAGG + Intronic
900477698 1:2883644-2883666 CTGGGGATTGGGGCTGGGTGAGG + Intergenic
900494368 1:2969737-2969759 CTGGGGGTGGGAGTGGAGTGAGG + Intergenic
900503380 1:3017307-3017329 CCGGGGATGGGAGGTGGGTGGGG + Intergenic
900696740 1:4016921-4016943 CAGGGGAGGGGAGGGGTGAGGGG + Intergenic
900798802 1:4725307-4725329 GTGGGGAAGGGATGTGAGTGGGG + Intronic
900948339 1:5843843-5843865 CTGGGCAGGGGAGGTGACTGAGG - Intergenic
901002983 1:6157943-6157965 CTGAAGTTGGGAGGTGTGGGAGG - Intronic
901199237 1:7457417-7457439 CAGGTGAGGGGAGGTGGGTGGGG + Intronic
901342855 1:8511042-8511064 ATGGGGTTGGGCGGTGAGTGCGG - Intronic
901662598 1:10807985-10808007 CTGGGGCTGGGAGGTGGGGAAGG - Intergenic
901769733 1:11524191-11524213 CTGGGGATGGGGGGTGAATTTGG + Intronic
901836966 1:11930428-11930450 GTGGAGACGGGAGGTGGGTGGGG + Intergenic
902640448 1:17763245-17763267 CTGGGGAGCGGGAGTGTGTGGGG + Intronic
902771568 1:18648196-18648218 TTGGGGAGGGGAGGTGACTGGGG - Intronic
902955471 1:19922038-19922060 CTGGAGCTGGGAGGTGTCTGTGG + Intronic
903183483 1:21617145-21617167 CTGGGGACTGGGAGTGTGTGTGG + Intronic
903210739 1:21816736-21816758 ATGGGGAAGGTAAGTGTGTGGGG - Intronic
903645895 1:24896397-24896419 ATGGTGATGGGAGGTGGGAGAGG - Intergenic
903661008 1:24978676-24978698 CTGGGGCTGGGAGGGGTGGGTGG - Intergenic
903787404 1:25870445-25870467 TTGGGGAGGAGAGGTGTGGGAGG - Intronic
903847165 1:26285378-26285400 CTCAGAATGGGAGGTGTCTGGGG + Intronic
904117814 1:28175424-28175446 GTAGGGGTGGGAGGTGTGTTGGG - Intronic
904384284 1:30131430-30131452 CAGGGGATGGGAGGAGAGAGAGG + Intergenic
904421669 1:30398292-30398314 CTGGGGATGGAGGGGGAGTGAGG + Intergenic
904421690 1:30398372-30398394 CTGGGGATTGAAGGAGAGTGAGG + Intergenic
904421727 1:30398479-30398501 CTGGGGATTGAAGGAGAGTGAGG + Intergenic
904772471 1:32887825-32887847 CAGGGTATGGGAGTTGTGCGTGG + Intronic
904873528 1:33636326-33636348 CTGGGGATGGCAGGGGTCTGAGG - Intronic
905393252 1:37651389-37651411 CTGGGGATTGGAGGGGTGGAGGG - Intergenic
905442856 1:38005741-38005763 CTGGGGATGGGGGGTGGGAGGGG - Intergenic
905546930 1:38807531-38807553 CTGGAGATGGGAGGTTGGAGGGG - Intergenic
905905219 1:41613267-41613289 CTGGAGAGGGGAGCTGTGAGTGG - Intronic
905908887 1:41640285-41640307 CGGGGGAAGGTAGGTGTGGGAGG + Intronic
905914397 1:41674929-41674951 CAGAGGATGGGACCTGTGTGGGG - Intronic
906390705 1:45413051-45413073 CTGGGGAGTGGAAGTGAGTGGGG + Intronic
906614308 1:47224482-47224504 TTTGGGAGTGGAGGTGTGTGTGG - Intronic
906634848 1:47402570-47402592 GTGGAGTTGGGAGCTGTGTGTGG - Intergenic
906655662 1:47546531-47546553 GTGGTGATGGCAGGTTTGTGTGG + Intergenic
906942919 1:50271865-50271887 GTGGGGGTGGGAGGTGGGAGCGG - Intergenic
907185537 1:52606324-52606346 CTGTGGATGTGCTGTGTGTGTGG + Intronic
907316398 1:53575406-53575428 TTGGAGATGAGAGTTGTGTGAGG - Intronic
907324358 1:53627201-53627223 CTGGGAGGGGGAGGTGTGGGCGG + Intronic
907547422 1:55274411-55274433 GTGGGGGTGGGCTGTGTGTGTGG + Intergenic
907850485 1:58250330-58250352 CTGGGGCTGGCAGGTCCGTGTGG + Intronic
908512331 1:64859425-64859447 CTGGTGATGGGCAATGTGTGAGG - Intronic
908880581 1:68727279-68727301 CTGGAGATGGGAGGAGGGAGAGG - Intergenic
911082245 1:93944763-93944785 CTGGGGAAGGGAGGTGAAGGCGG - Intergenic
911096788 1:94061653-94061675 GTGGGGAAGTGAGGTGGGTGTGG - Intronic
911338715 1:96611880-96611902 ATGGGGTTGGGAGGTGGGGGAGG - Intergenic
911950945 1:104172696-104172718 CTGAGGAGTGCAGGTGTGTGTGG + Intergenic
912156605 1:106928743-106928765 CTGGGGATGGGGAGTGAGTGGGG + Intergenic
912460661 1:109828756-109828778 CAGGGGATGGGGCGGGTGTGGGG + Intergenic
912502013 1:110128997-110129019 CTGGGGGTGGGGAGTGAGTGGGG + Intergenic
912800458 1:112716646-112716668 GTGTGGATGGGTGGTGTCTGTGG - Intergenic
912917738 1:113833750-113833772 ATGGGGGTGGGAGGGGTTTGTGG - Intronic
913223505 1:116678546-116678568 CTGGGCATGGGATTTGTGTATGG - Intergenic
913240584 1:116826257-116826279 CTGGGTATATGGGGTGTGTGAGG - Intergenic
913240595 1:116826298-116826320 CTGGGTGTGTGGGGTGTGTGAGG - Intergenic
913975540 1:143451740-143451762 CTGGGGGTGGGGGGGGTGGGGGG - Intergenic
914221356 1:145684805-145684827 CTGGGAAGGGTATGTGTGTGGGG - Intronic
914473922 1:148007672-148007694 CTGGGAAGGGTATGTGTGTGGGG - Intergenic
915057548 1:153149107-153149129 CTGTGTGTGGGAGGTGTGTGGGG + Intergenic
915111378 1:153566462-153566484 CTGGGGAGGACATGTGTGTGGGG - Intronic
915594805 1:156890402-156890424 TAAGGGATGAGAGGTGTGTGTGG - Intergenic
915602723 1:156932349-156932371 CTGGGGATGTCTGGTGTGTCAGG + Intronic
915737863 1:158095944-158095966 CTGGGGAGAGGAGGCTTGTGTGG - Intronic
916296326 1:163224203-163224225 CTGGGGAGGGGAGGGGAGGGAGG - Intronic
916993574 1:170270989-170271011 TTTGGGATGGGTGGTTTGTGGGG + Intergenic
917996031 1:180439294-180439316 CTGGGGAGGGGCCGGGTGTGGGG + Intronic
918235272 1:182574354-182574376 CTGGGTATGGGAAGTGAGGGAGG + Exonic
919834921 1:201567049-201567071 CTGGGGATGGGGGGTGGGAGGGG - Intergenic
919911458 1:202113440-202113462 CTGGGGAAGGGAGATATGAGAGG + Intergenic
919972566 1:202590572-202590594 CTGGGGGTGGGGGGTGTCTCTGG - Exonic
920077030 1:203344707-203344729 TTGGGGATGGGGGGTGTTGGAGG - Intronic
920108281 1:203569715-203569737 CTGGGCATGGGCTGGGTGTGGGG + Intergenic
920172789 1:204082061-204082083 CTGGTGGTGGGGTGTGTGTGGGG + Intronic
920682149 1:208081447-208081469 CTGAGGGTAGGAGGAGTGTGGGG + Intronic
920950166 1:210565057-210565079 CTGGAGATGGGAGGTGGGAAGGG + Intronic
921215573 1:212934070-212934092 CAGGAGATGGGAGGTTTATGAGG - Intergenic
921573362 1:216804768-216804790 TTGGGGAAGGGGGGTATGTGTGG - Intronic
922770951 1:228182672-228182694 GTGGGGACGGGGTGTGTGTGGGG + Intergenic
922801138 1:228365242-228365264 CTTGGGATGAGAGGTGTTGGGGG + Intronic
922856899 1:228783232-228783254 ATGGGGAGGGGATGTGTGTGAGG + Intergenic
922914141 1:229241651-229241673 CTTGAGATGGGATGTGGGTGGGG - Intergenic
923030187 1:230243437-230243459 CGGGGGCTGGGAGGGGTGTCAGG + Intronic
923051853 1:230395319-230395341 CTGGGATGGGGAGGAGTGTGAGG - Intronic
923051920 1:230395547-230395569 CTGGGATGGGGAGGAGTGTGAGG - Intronic
923070211 1:230557353-230557375 CTGGGGATGGGAGGGAGGTCAGG + Intergenic
923436780 1:233975004-233975026 CTGGGCATGGAAGGTGAGCGAGG + Intronic
924610213 1:245567455-245567477 CTGGGGATGGGAGGGGTGAAGGG - Intronic
924643985 1:245860164-245860186 GTGGGAGTGGGAGGGGTGTGGGG - Intronic
924940465 1:248809861-248809883 TGGGGGATGGGAGGGGTTTGAGG - Intergenic
1063118342 10:3086688-3086710 CTGGGGAGGGGTGGGGAGTGAGG + Intronic
1063224966 10:4007180-4007202 CTTGGGATGGGAGGTCTGCTTGG + Intergenic
1063401628 10:5751998-5752020 CTGGGGTTGGGAGGAGGATGGGG - Intronic
1063723459 10:8609826-8609848 CAGGGGATGGGGGGTGGGGGAGG + Intergenic
1063963833 10:11329202-11329224 CTGGGTAGGGGAAGTGGGTGGGG - Intronic
1063996264 10:11622860-11622882 TTGAGGAAGGGTGGTGTGTGTGG - Intergenic
1064670960 10:17713499-17713521 TCGGGGGTGGGAGGGGTGTGGGG - Intronic
1064710708 10:18121457-18121479 CTGTGAATGTGAGGTGTGTGAGG + Intergenic
1065290399 10:24223839-24223861 CTGGGGGTGGGCGGGGTGGGTGG - Intronic
1065828504 10:29593910-29593932 CTGGGGTTGGGAGGGGAGGGAGG + Intronic
1066003383 10:31125299-31125321 TTGGGGATGGGAGGAAAGTGGGG + Intergenic
1066021192 10:31304167-31304189 ATGGGGAGGGGAGGAGAGTGGGG + Intergenic
1066108009 10:32172361-32172383 CCTGGGGTGGGAGGTGTGGGGGG - Intergenic
1067013048 10:42732379-42732401 GTGGGCATGGGGTGTGTGTGTGG - Intergenic
1067077141 10:43194447-43194469 CTGGGGCAGGGAGGAGGGTGAGG - Intergenic
1067214811 10:44293117-44293139 CCGCGGGTGGGAGGTGGGTGGGG + Intronic
1067288793 10:44926787-44926809 CTGGGGGTGGGGGGTGGGAGGGG - Intronic
1067682168 10:48448178-48448200 CTGGGGACTGGAGATGTGTGGGG - Intronic
1067728663 10:48792868-48792890 CTGGGGATGGTGGGTGGGCGCGG + Intronic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1067924782 10:50497159-50497181 GTGGGGAAGAGAGGTGTGGGTGG - Intronic
1068479885 10:57577129-57577151 CGGGGGATGCGGGGTGGGTGGGG + Intergenic
1068577205 10:58697914-58697936 ATGGGGGTGGGAGGTGGGGGAGG - Intronic
1069415695 10:68198860-68198882 GGGGGGATGGGAGGGGTGAGGGG + Intronic
1069607532 10:69749218-69749240 CTGGGGAATGGAGGGGTGGGGGG - Intergenic
1069789855 10:71012549-71012571 CTGGGGATGGGGGTGGCGTGGGG + Intergenic
1069899402 10:71698538-71698560 TTGGGGATGGGTGGTGGTTGTGG - Intronic
1070599117 10:77853578-77853600 CTGGGGTGGGGCGGGGTGTGAGG - Intronic
1070769113 10:79071963-79071985 CTGGGGGTGGGGGCTGGGTGGGG + Intronic
1071342963 10:84665239-84665261 GTGGGGATGGGCGGGGTGTTAGG + Intergenic
1072686378 10:97539773-97539795 CTGGGGATATGATGTGTGGGAGG + Intronic
1073112325 10:101070087-101070109 ATGGGGAAGGGAGGTGGGGGTGG - Intergenic
1073215638 10:101834536-101834558 CTGTGGTTGGGAGGCTTGTGGGG - Intronic
1073267456 10:102236429-102236451 CTAGGGATGTGAGGGATGTGTGG + Intronic
1073391759 10:103183679-103183701 GTGGGGGTGGGAGGAGGGTGAGG + Intronic
1073462459 10:103673902-103673924 CTGGGGAGGGGAGGGGTGACAGG + Intronic
1073511510 10:104045544-104045566 GTGGGGTGGGGAGGTGTTTGGGG + Intronic
1074216639 10:111391426-111391448 CTTTGGATGGGAGTTGGGTGTGG - Intergenic
1074410671 10:113225769-113225791 CTGGAGATGGGAGATGTGTTAGG + Intergenic
1074436894 10:113441971-113441993 CTGGGGATGCGAGCTGTCTTTGG - Intergenic
1074580199 10:114711834-114711856 CTGAGGGTGGGAGGAGAGTGTGG - Intergenic
1075060931 10:119256281-119256303 CTGGTGCTGTGAGGTGTGTGGGG - Intronic
1075092433 10:119451144-119451166 GTGGGGATGGGATGACTGTGGGG - Intronic
1075316881 10:121460093-121460115 TTTGGGGGGGGAGGTGTGTGGGG - Intergenic
1075358175 10:121802689-121802711 CTGGGGATGGGAGCAGTGGGTGG - Intronic
1075602879 10:123783560-123783582 ATGTGAGTGGGAGGTGTGTGTGG + Intronic
1075709709 10:124524206-124524228 CTGGGGCTGGGTGGAATGTGGGG - Intronic
1075911679 10:126130572-126130594 CTGGGGATGCGGGGTGGATGTGG + Intronic
1076059254 10:127400772-127400794 CTGGGGGTGGGAGGTGGGTGAGG - Intronic
1076097381 10:127742922-127742944 ATGGGGTTTGGTGGTGTGTGTGG - Intergenic
1076131878 10:128019117-128019139 CTGGGGCTGGGAGGGGAGAGGGG - Intronic
1076384337 10:130045987-130046009 CTGGGCATGGGAGGTGGGGCTGG + Intergenic
1076533433 10:131160475-131160497 CTGGGCATGGGAGGTAAGGGTGG - Intronic
1076584637 10:131537250-131537272 CTGGGGGTGGGGGCTGGGTGGGG - Intergenic
1076687515 10:132204704-132204726 CTGGTGGTGGCAGGTGTGCGGGG + Intronic
1076996873 11:301662-301684 CTGGGGGTGGGGGGGGTGGGGGG + Intergenic
1077020373 11:414522-414544 GTGGTAATGGGAGGTGTGTGTGG - Intronic
1077441007 11:2569199-2569221 CTGGAGATGGCAGGGGTGTAAGG - Intronic
1077460947 11:2709227-2709249 CTGGGGCTGGGGGGTGGGGGTGG - Intronic
1077490866 11:2860368-2860390 CTGGGGATGGGTGGGCTGTGGGG - Intergenic
1078314407 11:10280828-10280850 CTGGGGATTGGGGGTGGGGGAGG + Intronic
1078549974 11:12273421-12273443 CTGGGGATGGAAGGCATTTGAGG - Intergenic
1078662988 11:13302109-13302131 GTGGGGATGGGAGGAGGGTTTGG + Intronic
1078884780 11:15489487-15489509 CAGGGAATCTGAGGTGTGTGTGG + Intergenic
1080621183 11:33988493-33988515 CGGGGGGTGGGGGGTGGGTGGGG - Intergenic
1080639180 11:34148834-34148856 CTGAGGCTGGGAGGTGGGGGAGG + Intergenic
1080975901 11:37340035-37340057 ATGAGGTAGGGAGGTGTGTGGGG - Intergenic
1081641820 11:44761186-44761208 CTGGGGCTGGGAGGGTTGTCGGG + Intronic
1081831713 11:46120721-46120743 AGGGGGAGGGGAGGGGTGTGTGG - Intronic
1081874242 11:46397726-46397748 CTGGGGTGAGGAGGTGTGGGCGG + Exonic
1081967625 11:47179118-47179140 GTGGGGATGGGAGGTGGGATGGG - Intronic
1082162458 11:48900440-48900462 CTGGGGCTGGAAGGTGGGCGCGG + Intergenic
1082168043 11:48968908-48968930 CTGGGGCTGGAAGGTGGGCGTGG + Intergenic
1082235502 11:49817728-49817750 CTGGGGCTGGAAGGTGGGCGCGG - Intergenic
1082244855 11:49910499-49910521 CGGAGGGTGGGAGGTGTGAGAGG - Intergenic
1083186041 11:61018404-61018426 CTGGGGAAGGGATGTGGGAGGGG + Intronic
1083318876 11:61833141-61833163 CTCGGCAGGGCAGGTGTGTGAGG - Intronic
1083421006 11:62553343-62553365 CTGGGGAGGGGAGCTGGCTGGGG - Intronic
1083691429 11:64411274-64411296 CTGGGGGTAGCAGGTATGTGGGG + Intergenic
1083695096 11:64437379-64437401 CTGGGGTGGGGACGGGTGTGAGG - Intergenic
1083704689 11:64505847-64505869 CTGGGGTCTGGGGGTGTGTGGGG + Intergenic
1083811959 11:65111277-65111299 TTGGGGACTGCAGGTGTGTGTGG - Intronic
1083823726 11:65186741-65186763 CTGGGGAGCGGAGTTGAGTGTGG - Intronic
1084062782 11:66686950-66686972 CTCGGGATGGGAGGAGAGTTGGG - Intronic
1084575258 11:69984950-69984972 CTGGAGATGTCAGGGGTGTGAGG + Intergenic
1084600314 11:70141629-70141651 CTGCGGCTGAGAGGTGTGAGCGG + Intronic
1084698900 11:70773043-70773065 CTGGGGATGGGCGGAGACTGGGG - Intronic
1084770108 11:71337105-71337127 CTGGTGACAGGAGGTGTGCGTGG - Intergenic
1084898871 11:72294911-72294933 CTCAGGGTGGGAGTTGTGTGAGG + Intronic
1085186188 11:74578043-74578065 CTAAGGATGTGAGGAGTGTGGGG - Intronic
1085393509 11:76194540-76194562 CTGGGGGTGGGTGGGGTGGGTGG + Intronic
1085440676 11:76559753-76559775 CTTGGGTTGGGAGGTGACTGGGG + Intergenic
1085508860 11:77075192-77075214 AAGGGGAGGGGAGGGGTGTGGGG - Intronic
1085733413 11:79018472-79018494 GTGGGGTAGGGATGTGTGTGGGG - Intronic
1085877276 11:80424107-80424129 CTGGAGAGGGGAGCTATGTGGGG + Intergenic
1086018710 11:82199428-82199450 GAGAGGATGGGAGGTGGGTGAGG + Intergenic
1089013320 11:115147626-115147648 GTGGGAAGGTGAGGTGTGTGTGG + Intergenic
1089492928 11:118894945-118894967 ATTAGGATGGGAGGTGCGTGAGG - Exonic
1089698411 11:120229531-120229553 ATGGGGAAGGGAGTTGTGTCTGG - Exonic
1089846983 11:121466298-121466320 CTGGGTGTGGGACCTGTGTGGGG + Intronic
1089962226 11:122626227-122626249 CTTGAGGTGGGAGGTGTCTGAGG - Intergenic
1090239459 11:125171844-125171866 TTGGGGATGAGGGGTGTCTGGGG + Intronic
1090253596 11:125267613-125267635 CTGGCGCTGGGAGATGTTTGGGG - Intronic
1090663049 11:128895378-128895400 CTGGGGTTGGGGGGGGGGTGGGG - Intronic
1090905738 11:131073181-131073203 CTGAGGCAGGGAGGTGGGTGAGG - Intergenic
1091002692 11:131923837-131923859 CTGGGGATGGGAGGAGGGTCGGG - Intronic
1091015843 11:132050149-132050171 CTGGGGAAGGGAGAAGGGTGAGG + Intronic
1091277598 11:134362838-134362860 CTGGGGCTGGGAGTGGGGTGAGG + Intronic
1091278757 11:134370210-134370232 CTGTGGATGGGAGCCGGGTGGGG + Intronic
1091280558 11:134379469-134379491 CTGGGGAGGGCAGGAGTTTGAGG + Intronic
1091317344 11:134623917-134623939 CTGGGGCTGGGACTTGTGTTGGG - Intergenic
1091760803 12:3085903-3085925 CTGGGGGTGGAAGTTGTTTGCGG + Intronic
1091911544 12:4234582-4234604 CAGGGGCTGGGAAGGGTGTGTGG - Intergenic
1092926996 12:13280314-13280336 CTGGGCATGGAAGGTTTGGGGGG + Intergenic
1093012806 12:14126725-14126747 CTGGGTTTTGGAGTTGTGTGAGG - Intergenic
1093460561 12:19403592-19403614 CTGCGGGTGGGAGCTGTTTGGGG - Intergenic
1094201337 12:27797512-27797534 TTGGGAGTGGGAGGTGAGTGCGG + Intronic
1095520193 12:43054728-43054750 CTAGGGGTGGGAGGAGGGTGTGG - Intergenic
1095570254 12:43675876-43675898 CTGGCGATGGGTGGGGTGTGTGG - Intergenic
1095691369 12:45093128-45093150 CTGGGGTTGAGAGGTACGTGTGG - Intergenic
1096077340 12:48814056-48814078 CCGGGGATGGGAGGATTGAGGGG + Intronic
1096574292 12:52543182-52543204 GTGGGGAGGGGAGGTGTAGGAGG - Intergenic
1096651458 12:53063933-53063955 CAGGGGATGTGAGGGCTGTGGGG - Exonic
1096779637 12:53984624-53984646 TTGGGGATGGGAGTGGGGTGAGG - Intergenic
1096877745 12:54643884-54643906 CTGGGGATGGGAGGTTGGTGGGG + Intergenic
1096889195 12:54749588-54749610 CTGGGGAGGGTGGGTGTGGGTGG + Intergenic
1097221132 12:57451820-57451842 CTGGGGGTCGGGGATGTGTGGGG - Intergenic
1097224564 12:57469706-57469728 CTGGGTGTGGGAGGTGTGGCTGG + Intronic
1097267439 12:57754616-57754638 CTGGGAAAGAGAGGTGTGTAAGG - Intronic
1097276041 12:57814259-57814281 ATGGGGAAGGGAGGTGGGAGGGG - Intronic
1097669554 12:62519311-62519333 CTGGGGGTGGGTGGTGAGAGGGG + Intronic
1098095153 12:66946778-66946800 TGGGGGATGGGGGGGGTGTGGGG + Intergenic
1098763944 12:74461093-74461115 ATGTGGATGGGGGGTGTGGGAGG + Intergenic
1098765792 12:74487095-74487117 TTGGCGATGTGAGGTTTGTGAGG + Intergenic
1098947695 12:76606724-76606746 TTGAGGATGGGAGGTGGGGGTGG + Intergenic
1099603228 12:84768286-84768308 CGGAGGGTGGGAGGAGTGTGAGG - Intergenic
1099965390 12:89440044-89440066 CTGGGGATGGGGGATGCATGTGG - Intronic
1100432949 12:94546780-94546802 CTGGGGAAGGGTGAAGTGTGAGG + Intergenic
1100457334 12:94765172-94765194 ATAGGGATGGGAGGGGTCTGAGG - Intergenic
1100730491 12:97462220-97462242 CTGGGGGTGGGAGGTGTTTTGGG + Intergenic
1101036840 12:100715749-100715771 CTGGGGTTGGGTAGAGTGTGAGG + Intergenic
1101211483 12:102539231-102539253 GTGGGGAGGGGACATGTGTGAGG + Intergenic
1101970527 12:109309395-109309417 CTGGGGGGGGGGTGTGTGTGAGG + Intergenic
1102217382 12:111170982-111171004 ATGGGAATGGGAGGGGAGTGGGG + Intronic
1102519709 12:113470801-113470823 AAGGGGTTGGGAGGTGGGTGGGG + Intronic
1102574169 12:113845331-113845353 CTGGGGGTGGGAGCTGGGAGCGG - Intronic
1102625906 12:114235336-114235358 CTGGGGAGGAGTGGTGGGTGGGG - Intergenic
1102864268 12:116361571-116361593 CTGGGGGTGGGAGGTGGGACAGG - Intergenic
1102954841 12:117052751-117052773 CTGGGGGTGGGTTGGGTGTGGGG - Intronic
1103075426 12:117978713-117978735 AAGGGGATGGAATGTGTGTGTGG + Intergenic
1103098352 12:118150371-118150393 TTGGGGACGGGGGGTGGGTGGGG - Exonic
1103698398 12:122835186-122835208 GTGGGGGTTGGAGGTGTGCGGGG + Intronic
1103716232 12:122947018-122947040 TTGGCCATGGGCGGTGTGTGTGG + Intronic
1103722729 12:122983211-122983233 CTGGGGCTGGGTGGCCTGTGTGG + Intergenic
1103797218 12:123512268-123512290 CTGTGTGTGGGTGGTGTGTGAGG + Intronic
1104048700 12:125182507-125182529 CAGGGGCTGGGAAGGGTGTGAGG - Intergenic
1104106508 12:125664987-125665009 CTGGTGATGAGAAGTGTGTTTGG + Intergenic
1104557816 12:129817783-129817805 CTGTGGTTTGGGGGTGTGTGGGG + Intronic
1104655899 12:130573839-130573861 CTGGGGATGGGATTTCTGTGTGG - Intronic
1104754483 12:131260494-131260516 CTGGGGCTGGGAGGGGCATGAGG + Intergenic
1104880904 12:132069580-132069602 CTGGGCCTGGGAGATGGGTGTGG - Exonic
1104946881 12:132418990-132419012 CTGGGGAAGGGAGTTCCGTGGGG + Intergenic
1105449521 13:20486447-20486469 GTGGGGGTGGGAGGATTGTGTGG - Intronic
1106110271 13:26771036-26771058 GTGGGGGTGGGGGGTGTGGGGGG + Intergenic
1108323355 13:49307115-49307137 CTGGGGATGGGGGGCGGGTATGG - Intergenic
1108408503 13:50126133-50126155 CTGGGGAGGGCAGAGGTGTGAGG + Intronic
1108501297 13:51072185-51072207 CTGGGGATGGGGGTGGGGTGGGG - Intergenic
1109254411 13:60061610-60061632 GTGGGGGTGGGAGGTGTGTGTGG - Intronic
1109673993 13:65648711-65648733 CTGAGGAAGGGAGGAGTGTACGG + Intergenic
1110116156 13:71819066-71819088 CTGGGGCTGCCAGGTGTGGGAGG + Intronic
1110758888 13:79208190-79208212 CTGGGGAGGGGTGGACTGTGAGG + Intergenic
1111176465 13:84602663-84602685 CAGAGGCTGGGAAGTGTGTGTGG - Intergenic
1111192948 13:84833057-84833079 CCGGGGATGGGAGGGGGATGAGG - Intergenic
1111655396 13:91145634-91145656 TTGGTGAGGGGAGGTGTGTGTGG + Intergenic
1112338331 13:98532514-98532536 ATGGGTATGGGATGTGTGTGTGG - Intronic
1112669871 13:101622885-101622907 ATGAGGCTGGGATGTGTGTGTGG + Intronic
1112927724 13:104697107-104697129 ATGGGGGTGGGAGGTGGGTAGGG - Intergenic
1113095965 13:106664001-106664023 CTGGGCATGGGAGGTGGGGGTGG - Intergenic
1113263523 13:108592335-108592357 CTGTGTGTGGGATGTGTGTGTGG + Intergenic
1113361994 13:109640287-109640309 CTGGGGATGGGCTGGGTGTGAGG - Intergenic
1113459398 13:110471366-110471388 CTGGGGGTGGGTGGTGATTGAGG + Intronic
1113483938 13:110641154-110641176 CTGGGGATGGGTGAGGTGGGTGG - Intergenic
1113566662 13:111323341-111323363 CTGGGGAAGAGGCGTGTGTGGGG + Intronic
1113670118 13:112170675-112170697 CTGGGGGAGGGAGGGGTGTGGGG - Intergenic
1113802983 13:113096100-113096122 CTGGGGCCGAGAGCTGTGTGTGG + Intronic
1113916104 13:113874989-113875011 CTGGGAAGGGGAGGTAAGTGGGG + Intergenic
1113917366 13:113882622-113882644 CTGGGGTTGGGTGGGGTGTTTGG - Intergenic
1113966428 13:114155859-114155881 CTGGGGGTGGAGGGTGGGTGTGG + Intergenic
1114191182 14:20440501-20440523 CTAGGGGTGGTATGTGTGTGGGG + Intergenic
1114231548 14:20787305-20787327 GTGGGGATGGGAAGTCTTTGGGG + Intergenic
1114265188 14:21069622-21069644 CTGGGGAAGGCGGGAGTGTGCGG - Intronic
1114410089 14:22492796-22492818 TTGAGCATGGGTGGTGTGTGGGG - Intergenic
1114573524 14:23692729-23692751 CTGGAGCTGGGGGGTGTCTGGGG - Intergenic
1114617973 14:24078262-24078284 CTGGGGTTGGGAGGTGAGGGAGG - Intergenic
1115443585 14:33463888-33463910 GTGGGGATGGGAGGTTTTTGTGG + Intronic
1116135784 14:40921765-40921787 CCGGGGATGGGAGGAGAGGGAGG - Intergenic
1116536327 14:46035755-46035777 CTAGAGATGGGAGGTTGGTGTGG + Intergenic
1117026351 14:51624151-51624173 CAGGGGATGGGAGGAGGGAGAGG + Intronic
1117652095 14:57917906-57917928 GTGAGGAGGGGATGTGTGTGGGG - Intronic
1118013018 14:61629050-61629072 CAGGGGAGGGGAGGGGTCTGGGG + Intronic
1118163143 14:63310973-63310995 CAGGGGATGGGAGGAGAGTGAGG + Intergenic
1118508703 14:66445818-66445840 GTGGGGATGGGGGGTGGGGGAGG - Intergenic
1118815825 14:69313322-69313344 CTGCGGATGGAGGGAGTGTGAGG - Intronic
1119175753 14:72566604-72566626 ATGGGGAAGGGTGGAGTGTGGGG - Intergenic
1119717059 14:76866928-76866950 GGGGGGGTGGTAGGTGTGTGGGG + Intronic
1119717110 14:76867110-76867132 GGGGGGATGGGGTGTGTGTGTGG + Intronic
1119771202 14:77221415-77221437 GTGGGGAGGGGAGGCGTGAGTGG - Intronic
1119779806 14:77270417-77270439 CCGGGGAAGGGAGATGTGTGGGG - Intronic
1120263431 14:82218231-82218253 CTGGGGATGGGAGCTTTTTCAGG - Intergenic
1120295653 14:82636902-82636924 TTGGGGAGGCAAGGTGTGTGGGG + Intergenic
1120527517 14:85594325-85594347 CTGGGGATTTGTGTTGTGTGTGG + Intronic
1120739553 14:88092540-88092562 CTGGACAAGGGAAGTGTGTGAGG + Intergenic
1121043550 14:90771038-90771060 CTGGGGGTGGGAGGGGAATGGGG + Intronic
1121736387 14:96220901-96220923 TTGGGGACAGGAGGTGTGGGAGG - Intronic
1122266245 14:100548294-100548316 CTGGGGAGGACAGGTCTGTGTGG - Intronic
1122271291 14:100569398-100569420 CTGGGGAAGAGAGCGGTGTGGGG - Intronic
1122403025 14:101478683-101478705 CTGGAGGTGGGGGGTGGGTGTGG - Intergenic
1123054661 14:105563558-105563580 TTGTGGATGTGGGGTGTGTGAGG + Intergenic
1123703884 15:22936980-22937002 CTGGGGCTGGGTGGAGTCTGGGG - Intronic
1123931073 15:25171902-25171924 CTGTGTTTGGGAGGTGTGTAGGG + Intergenic
1123933176 15:25181659-25181681 CTGTGTTTAGGAGGTGTGTGGGG + Intergenic
1123935606 15:25192597-25192619 CTGTGTTTAGGAGGTGTGTGGGG + Intergenic
1124496875 15:30192424-30192446 AGGGGAAGGGGAGGTGTGTGCGG + Intergenic
1124624777 15:31301539-31301561 GTGGGGATGGCTGCTGTGTGTGG + Intergenic
1124746701 15:32346223-32346245 AGGGGAAGGGGAGGTGTGTGCGG - Intergenic
1125926679 15:43568785-43568807 TTGGGAATGGGAGGGCTGTGGGG - Intronic
1125939823 15:43668350-43668372 TTGGGAATGGGAGGGCTGTGGGG - Intergenic
1126090784 15:45049318-45049340 CTGGAGGTGGGGGTTGTGTGGGG + Intronic
1126108542 15:45162507-45162529 CTGGGGTTGGGTGGTGAGTGGGG + Intronic
1126407077 15:48332124-48332146 CCGGGGAGGGGCGGTGGGTGGGG + Intronic
1126908220 15:53389945-53389967 GTGGGGGTGGGAGTTGTGGGGGG + Intergenic
1127520922 15:59742329-59742351 CTGGGGCTGGGAGCTGTTTCTGG - Intergenic
1127594149 15:60461092-60461114 CTAGGGATGGGTGGGGTGGGGGG + Intronic
1128617676 15:69122637-69122659 CTGGGGTGGGGAGGTCTGAGAGG - Intergenic
1128776427 15:70323752-70323774 CTGGGGGTTGGTGGTGTTTGGGG - Intergenic
1129035490 15:72646254-72646276 CTTGGGATGGGAGGGATGAGGGG + Intergenic
1129214394 15:74090962-74090984 CTTGGGATGGGAGGGATGAGGGG - Intergenic
1129680943 15:77658004-77658026 CCGGGGGTGGGAGGGGAGTGGGG + Intronic
1130393217 15:83478035-83478057 ATGTGGATGTGAGGTGGGTGAGG + Intronic
1130884800 15:88083870-88083892 TTGGGGAGGGGAGGGGTGTAAGG + Intronic
1131032066 15:89194860-89194882 CTGGGGGTGGGAGGTGGGAGAGG - Intronic
1131748997 15:95485474-95485496 CTAGGGATGGAAGATGTATGTGG + Intergenic
1132509018 16:327634-327656 CCCGGGATGGCAGGTGTGGGTGG - Intronic
1132587852 16:714109-714131 CAGGGCATGGGTGGTGGGTGGGG - Intronic
1132720364 16:1312655-1312677 CTGCGGCTGCGAGGTGTGTGAGG + Intronic
1132843500 16:1989839-1989861 TGGGGGATGGGAGGTGGGCGCGG + Intronic
1132875402 16:2134950-2134972 CTGGCCACGGGAGGTGTGAGGGG - Intronic
1133072659 16:3256827-3256849 CAGGGTTTGGGAGGGGTGTGGGG - Intergenic
1134196673 16:12164191-12164213 CTGGGGTAGGGATGAGTGTGGGG + Intronic
1134519582 16:14912410-14912432 CTGGCCACGGGAGGTGTGAGGGG + Intronic
1134554349 16:15153825-15153847 CTGGCCACGGGAGGTGTGAGGGG - Intergenic
1134691254 16:16192221-16192243 TTGAGGATGGGAGATGTGTGGGG + Intronic
1134707254 16:16311066-16311088 CTGGCCACGGGAGGTGTGAGGGG + Intergenic
1134960287 16:18401059-18401081 CTGGCCACGGGAGGTGTGAGGGG - Intergenic
1135174265 16:20214405-20214427 CTGGGTAGGGGAGGCTTGTGGGG - Intergenic
1135249834 16:20891616-20891638 GTGGTGATGGGTGGTGGGTGTGG + Intronic
1135634459 16:24062223-24062245 CTGGGGCTGGAGGGTCTGTGAGG + Intronic
1136109236 16:28054256-28054278 CTGGGGATGGGAGGTGATGGAGG - Intronic
1136115013 16:28089027-28089049 GTGGGGGTGTGGGGTGTGTGGGG - Intergenic
1136272384 16:29156068-29156090 CTGCTGATGGGCGCTGTGTGCGG - Intergenic
1136381464 16:29898018-29898040 CTGGAGAAGGAAGGGGTGTGGGG - Intronic
1136559809 16:31032703-31032725 CAGGGGCTGGGGGGTGTGAGTGG + Intergenic
1136620283 16:31423946-31423968 CTGGGTCCGCGAGGTGTGTGGGG + Exonic
1137429874 16:48410043-48410065 TTTGGGAAGGGTGGTGTGTGAGG - Intronic
1137469171 16:48739346-48739368 CTGGGTATGGGAGGTGACAGAGG - Intergenic
1137496161 16:48970986-48971008 CTGGGGATGGGATGTGGTTCAGG + Intergenic
1137586704 16:49668199-49668221 CTCAGCATGGGAGGTGGGTGGGG - Intronic
1137605622 16:49784987-49785009 CTGGGGCTGGGAGGGGTAGGAGG + Intronic
1137984835 16:53099062-53099084 CTGAGGGTGGGAGGTGAGGGTGG + Intronic
1138291894 16:55855022-55855044 CTGGTGATGGAAGGGGTGGGTGG - Intronic
1138567159 16:57841883-57841905 GTGGGGATGGGGTGTGTGGGGGG - Intronic
1138598788 16:58043152-58043174 CTGGGGCTGAGGGGTGTGTGCGG - Intronic
1138600337 16:58050137-58050159 TTGGGGGTGGGAGGTGTCAGAGG - Intergenic
1139344281 16:66292537-66292559 CTGGGGAAGGGAGGTGAGAATGG - Intergenic
1139964785 16:70739283-70739305 CTGAGGCTGGGAGGGGTGAGTGG + Intronic
1140272084 16:73474933-73474955 ATGGGGCTGGGAGGAGTGGGTGG + Intergenic
1140396721 16:74633588-74633610 CTGGGGATGGGAGAGGAGGGAGG + Intronic
1140453796 16:75092807-75092829 CTGAGGCTGGGAGCTGGGTGAGG + Intronic
1140479725 16:75256166-75256188 CTGGCCATGGGAGCTGCGTGGGG - Intronic
1140807915 16:78550697-78550719 CTGGGGATGGCAGCAGAGTGGGG + Intronic
1140825212 16:78699975-78699997 TTGGGGAGGGGAGGTGGCTGGGG + Intronic
1141072893 16:80974090-80974112 CTGGGGAGGTGAAGTGTGTGTGG - Exonic
1141194009 16:81846056-81846078 CTGGTAATGGGAGCTGAGTGGGG - Intronic
1141413896 16:83855343-83855365 CAGGGGATGGTGGGTCTGTGGGG - Intergenic
1141589605 16:85059562-85059584 CTGGAGAAGAGGGGTGTGTGCGG - Intronic
1141635197 16:85310786-85310808 CTGGGCTGGGGAGGTGGGTGGGG - Intergenic
1142141285 16:88473874-88473896 CCAGGGATGGGATGTGGGTGGGG - Intronic
1142150832 16:88511937-88511959 CCAGGGATCGGAGGGGTGTGGGG - Intronic
1142306249 16:89287530-89287552 CAGGGGAGGGCAGGTGTGAGGGG - Intronic
1142673636 17:1499734-1499756 CTGGAGGTGGGGTGTGTGTGTGG + Intronic
1142761548 17:2044996-2045018 CTGGGTGTGGAAAGTGTGTGTGG + Intergenic
1142803952 17:2361977-2361999 CTGGGGTTGGGAGGTGAAGGAGG - Intronic
1142978740 17:3659605-3659627 CTGGAGCTGTGAGGTGTGGGGGG + Intronic
1143024977 17:3936257-3936279 CTGGCTATCGGAGGTGAGTGGGG - Exonic
1143199267 17:5100783-5100805 CAGGGGATTGGAGGAGTGTCAGG - Intergenic
1143380985 17:6496282-6496304 CTGGAGAGGGGTGGTGTGGGAGG - Intronic
1143513903 17:7409908-7409930 CTGGGGAGCACAGGTGTGTGTGG - Intronic
1143525351 17:7468730-7468752 CAGGGGATGGGAATTGTATGAGG - Intronic
1143564370 17:7712468-7712490 CTGGGGCAGGGTGGTGTGTGAGG + Intergenic
1143564989 17:7715845-7715867 CTGGGACAGGGATGTGTGTGGGG + Intergenic
1143576721 17:7798134-7798156 CTGGGGGTGGGGTGGGTGTGAGG - Intronic
1143616361 17:8052479-8052501 CTAGGGTTGTGTGGTGTGTGTGG - Intergenic
1143742018 17:8961271-8961293 CCTGGGATGGGTGGTGGGTGTGG + Intronic
1143744294 17:8979425-8979447 ATGGGGATGGGATTTATGTGGGG + Intergenic
1143848350 17:9790517-9790539 ATAGGGATGGGTGGGGTGTGTGG + Intronic
1143863514 17:9908004-9908026 CTGGGGATGGAGGGAGAGTGAGG + Intergenic
1144451819 17:15387039-15387061 GCGGGGAAGGGAGGTGAGTGTGG + Intergenic
1144643199 17:16950756-16950778 CGGGGGAGGGGAGGGGTGTGAGG - Intronic
1144671963 17:17138038-17138060 CTGGGGCTGGGAGGGGAGAGCGG - Exonic
1144750833 17:17647087-17647109 GTGGGGATTGGAGGTGGGTTCGG + Intergenic
1144960032 17:19039666-19039688 CTGGGGTTGGCAGGGGTGAGAGG + Intronic
1144975128 17:19134858-19134880 CTGGGGTTGGCAGGGGTGAGAGG - Intronic
1145055997 17:19704346-19704368 CTGGGGCTGGGAGAAGGGTGGGG + Intronic
1145101939 17:20084864-20084886 CTGGGCAAGGGAGGTGGGGGTGG + Intronic
1145270024 17:21399951-21399973 CTGGGGTTGGAAAGCGTGTGTGG + Intronic
1145308250 17:21687400-21687422 CTGGGGTTGGAAAGCGTGTGTGG + Intergenic
1145398094 17:22511877-22511899 CATGGGAGGGGAGGTGAGTGAGG - Intergenic
1145902112 17:28496061-28496083 CTGGGGTGGGGAGGTGGGTGAGG - Intronic
1146457217 17:33017415-33017437 AAGGGGATGGGAGGTTTTTGGGG - Intronic
1146955508 17:36934641-36934663 GCGGGGAGGGGAGGAGTGTGAGG + Intergenic
1147143844 17:38474244-38474266 CTGGGGATGGCAGGAGACTGGGG + Intronic
1147465094 17:40604898-40604920 CGGGGTATGGAAGGTGAGTGAGG - Intergenic
1147582163 17:41633514-41633536 CTGGGAGTGTGAGGTGTGAGTGG + Intergenic
1147649681 17:42054897-42054919 GTGGGCATGGGAGGGGTGTCAGG - Intronic
1147664799 17:42139792-42139814 CTGTGGCTGGGACGTGTGTGTGG - Intronic
1147717801 17:42519950-42519972 CAGGGGCTGGGAGGTGGCTGGGG - Intronic
1148153299 17:45409161-45409183 GGGAGGATGGGAGGTGTGTCTGG - Intronic
1148228362 17:45915412-45915434 GTGGGCATGTGATGTGTGTGTGG + Intronic
1148332608 17:46821267-46821289 CTAGTGAATGGAGGTGTGTGTGG + Intronic
1148353536 17:46958394-46958416 CTGGGGGTGGGAAACGTGTGTGG + Intronic
1148416529 17:47510916-47510938 CTGGGCATGGTCGGGGTGTGGGG - Intergenic
1148496204 17:48054801-48054823 CTGGGGTTGTGAGGTGGGAGGGG + Intronic
1148555631 17:48577247-48577269 GTGGGGAAGGGGGGCGTGTGAGG + Intronic
1148564912 17:48626908-48626930 CTGCGGGGTGGAGGTGTGTGTGG - Intronic
1148732336 17:49845131-49845153 CTGGGGAAGAGAGGTGAGTGGGG - Intronic
1148751087 17:49946314-49946336 CTGAGGCAGGGAGGTGTGTGAGG - Intergenic
1148757981 17:49984552-49984574 CTGGGGATGGGAACAGTGGGTGG - Intergenic
1149346899 17:55748028-55748050 CAGGGGATGGGATGGGTGGGTGG - Intergenic
1149751774 17:59153582-59153604 GTGGGAATGGGGGGTGGGTGAGG + Intronic
1150135909 17:62695029-62695051 CTGGGGATGGGATCTGCCTGGGG + Intergenic
1150226926 17:63529376-63529398 CTGGGCCTAGGAGGAGTGTGGGG - Intronic
1150252397 17:63714146-63714168 CTGGGGGTGGGATGGGAGTGGGG + Intronic
1150692307 17:67377282-67377304 CTGGGGCCGGGAGGTGGGTGCGG - Intronic
1151145276 17:72034687-72034709 CTATGGATGTGAGGTGTGTGAGG - Intergenic
1151175207 17:72282433-72282455 CTGGGGATGTGGAGGGTGTGCGG - Intergenic
1151404407 17:73877453-73877475 CTGTGGATGGGAGGTGAGGAAGG - Intergenic
1151404663 17:73878563-73878585 CTGGGGTTGGGAGGTGGTTGTGG + Intergenic
1151569332 17:74918260-74918282 CTGGGGCAGGGATGGGTGTGGGG - Intronic
1151718607 17:75843757-75843779 CTGGGGAAGGGAGGGAGGTGGGG - Intronic
1151748165 17:76022594-76022616 CTCCGGGTGGGAGGCGTGTGGGG - Intronic
1151775804 17:76200961-76200983 CTGGGGTTGGGATGTGTGCCAGG - Intronic
1151898666 17:76997245-76997267 CTGTGGTTGGGGGGTGGGTGCGG - Intergenic
1152022158 17:77785761-77785783 CTGGGCATGTGGGGTGCGTGTGG + Intergenic
1152023582 17:77794780-77794802 CGGGGGAGGGGAGGTGGGGGAGG - Intergenic
1152183346 17:78839315-78839337 CTGGGGATGGGAAGTGACTCAGG - Intronic
1152232299 17:79120070-79120092 CTGGGGTTGGGTGGTGTGAGCGG + Intronic
1152279103 17:79374975-79374997 CAGGGGAAGGGAGGTGGGTAGGG - Intronic
1152303685 17:79509350-79509372 CTGGGGCTGGAGGGGGTGTGGGG - Intronic
1152382055 17:79947173-79947195 CAGGGGAGGGGTGGGGTGTGAGG + Intronic
1152391438 17:80006148-80006170 CTGGGGTGGGGAGGGGTGTCAGG - Intronic
1152433633 17:80262414-80262436 CTGGAGAGGGGAGGTGTGCAGGG + Intronic
1152539471 17:80967684-80967706 CTTGGGCTGGGGGGTGTGTTGGG + Intergenic
1152626085 17:81388525-81388547 CTGGGTCTGGGAGGTGCTTGGGG + Intergenic
1152636593 17:81432830-81432852 CTGGGGATGGGGGGGGAGGGTGG - Intronic
1152695673 17:81792958-81792980 GTGGGGGTGGGTGGTGTGTGTGG - Intergenic
1152699954 17:81813800-81813822 CTGGGGGTGGGGGGTAGGTGGGG - Exonic
1152726969 17:81952296-81952318 CTGGGGAGGGGAGGTGGGGGAGG + Intergenic
1152797826 17:82316626-82316648 CTGGGGTTGGGAGGGGGGTCTGG + Intronic
1153434105 18:5049932-5049954 CTGAGGATTAGAGGTGGGTGAGG + Intergenic
1153662063 18:7333821-7333843 CTGAGTTTGGAAGGTGTGTGAGG - Intergenic
1154168747 18:12035672-12035694 CTGGAGATGTGAGGGGGGTGGGG + Intergenic
1155506133 18:26535100-26535122 CTGGGGTTGGGGGGTGGGGGTGG + Intronic
1155703750 18:28781861-28781883 TTGGGGATGGGAAGTGGGTTAGG + Intergenic
1155982244 18:32193751-32193773 CTGGGGGTGGGAGGACTGTGAGG - Intronic
1157497519 18:48166925-48166947 CTGGGGCTGGGGGCTGTGAGTGG - Intronic
1157701034 18:49761699-49761721 GTGGGGATGTGGGGTGTGTGGGG - Intergenic
1157701068 18:49761811-49761833 GGGGGGATGTGGGGTGTGTGGGG - Intergenic
1158230522 18:55249439-55249461 CTGTGGAGGACAGGTGTGTGGGG + Intronic
1158236796 18:55324677-55324699 CTGGGCATGGGGGGTGGGGGTGG - Intronic
1158512601 18:58104873-58104895 ATGGGTATGGGATGTGTTTGGGG - Intronic
1158693665 18:59683922-59683944 CTAGGGAAGGGAGGGGTTTGAGG - Intronic
1158963368 18:62604218-62604240 CTGAGGGTAGGAGGGGTGTGTGG + Intergenic
1158972562 18:62681747-62681769 CTGTGATTGGGAGGTGAGTGGGG + Intergenic
1159604638 18:70462269-70462291 TTGGGGTCGGGTGGTGTGTGGGG + Intergenic
1159919194 18:74212513-74212535 GTGGCGATGGGAGCTATGTGTGG - Intergenic
1160149221 18:76386440-76386462 AGGGGGATGGGAGGTGAGGGAGG + Intronic
1160322093 18:77905672-77905694 CTGGCCATGGGTGGTGTGAGGGG - Intergenic
1160496833 18:79380889-79380911 CTGGGGAAGCGGGGTGGGTGGGG - Intergenic
1160744580 19:704573-704595 CTGGAGTCGGGAGGTGTGGGCGG + Intergenic
1160756279 19:758521-758543 CTGGGGCTGGGAGGTGGCTGGGG + Exonic
1160818013 19:1045130-1045152 CTGGGGTTGGGTGCTCTGTGGGG - Exonic
1160844358 19:1159929-1159951 CCAGGGAAGGGAGGTGGGTGAGG + Intronic
1161085426 19:2332921-2332943 GTGGGGATGGCAGGTGCGGGCGG + Intronic
1161085447 19:2332982-2333004 GTGGGGATGGCAGGTGCGGGCGG + Intronic
1161085468 19:2333043-2333065 GTGGGGATGGCAGGTGTGGGCGG + Intronic
1161085506 19:2333164-2333186 GTGGGGATGGCAGGTGCGGGCGG + Intronic
1161085558 19:2333337-2333359 GTGGGGATGGCAGGTGCGGGCGG + Intronic
1161117926 19:2509535-2509557 ATGGGGATGGGATGTCTTTGGGG + Intergenic
1161373938 19:3929319-3929341 CTTGGGCTGGGAGTGGTGTGAGG - Intergenic
1161389030 19:4011689-4011711 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389035 19:4011706-4011728 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389040 19:4011723-4011745 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389045 19:4011740-4011762 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389050 19:4011757-4011779 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389055 19:4011774-4011796 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389060 19:4011791-4011813 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389065 19:4011808-4011830 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389070 19:4011825-4011847 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389094 19:4011908-4011930 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389099 19:4011925-4011947 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389104 19:4011942-4011964 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389109 19:4011959-4011981 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389114 19:4011976-4011998 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389119 19:4011993-4012015 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389124 19:4012010-4012032 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389129 19:4012027-4012049 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161389134 19:4012044-4012066 GTGGGGTGTGGAGGTGTGTGGGG + Intronic
1161483334 19:4521741-4521763 CTGGGGCTGGGCGGGGTGTTGGG - Intergenic
1161718821 19:5892231-5892253 CTGGGGCTGGGAGGTGCGAAGGG + Exonic
1161864197 19:6821905-6821927 CTGGGGGTGGAGGGTGTGGGGGG + Intronic
1161872386 19:6880159-6880181 CAGGGGATGGGAGGTGGGAGGGG + Intergenic
1162065621 19:8123698-8123720 CTGGAGATGGGAAGTGTGTTTGG - Intronic
1162174629 19:8822160-8822182 GTGGGTGTGGGAGGTGGGTGTGG - Intronic
1162475149 19:10895404-10895426 CTAGGGATGGGAGGTTTGAAGGG + Intronic
1162583784 19:11546781-11546803 GTGGGGAGGGGAGGTCTGAGGGG - Intronic
1162721663 19:12666533-12666555 CGGGGGATACGAGGTGAGTGGGG - Exonic
1162913386 19:13861923-13861945 CTGGGGACCGGGGGTGTGTAGGG + Intergenic
1162915176 19:13870906-13870928 CTGGGGATAAGTGGGGTGTGGGG - Intronic
1162948608 19:14057713-14057735 CTGTGGATGGGGGGTGTAGGGGG + Intronic
1163149452 19:15402354-15402376 CTGTGCCTGTGAGGTGTGTGGGG - Intronic
1163210760 19:15838463-15838485 CTGGGGATTGGGGGTGGGGGTGG + Intergenic
1163506324 19:17709195-17709217 CTGGGGTTTCGAGGAGTGTGTGG - Intergenic
1163633453 19:18428235-18428257 ATGGGGGTGGGAGGGCTGTGGGG - Intronic
1164822836 19:31263694-31263716 GTGGGGATGTGAGGAGTGGGGGG - Intergenic
1165126159 19:33599377-33599399 CTAAGGATGGGAGCTGAGTGCGG + Intergenic
1165140428 19:33696644-33696666 CTGGGGAAGGGAGATGGGGGTGG - Intronic
1165161919 19:33821275-33821297 CTGGGGCTGGAAGGTGGGAGTGG - Intergenic
1165384226 19:35501109-35501131 CTGGGGCTGGGGGGGGTGTCCGG - Intronic
1165749371 19:38250987-38251009 CTGGGGATGGGGGTGGGGTGGGG + Intronic
1165811459 19:38614346-38614368 CTGGGGATGGGAGGGGAGGGTGG - Intronic
1165858269 19:38893347-38893369 CTGGGGATGGGAGGTCACTTGGG + Intronic
1165858765 19:38895536-38895558 CCGGGGAAGGGAGTTGTCTGAGG - Intronic
1166390614 19:42407052-42407074 CAGGAGCTGGGAGGTGTGGGGGG + Intronic
1166781297 19:45344995-45345017 CTGGGGGTGGGTGGGGTGGGAGG - Intronic
1166803825 19:45473317-45473339 CTGGGGATGGGTGGGGAGGGGGG + Exonic
1166870551 19:45867837-45867859 TTGGGGTTGGGAGGGGAGTGGGG + Intronic
1166871313 19:45872739-45872761 CTGGGGCGGGGAGGTGACTGTGG - Exonic
1167120320 19:47512904-47512926 CTGGGGATGGGAAGAGACTGTGG - Intronic
1167419674 19:49395523-49395545 CTGGAGAAGGGAGGAGTTTGGGG + Intronic
1167454820 19:49592537-49592559 CTGGGGATAGGTGAAGTGTGAGG - Intronic
1167663524 19:50810414-50810436 GTGGGGATGGGTGGTGGTTGGGG + Intergenic
1167666215 19:50823908-50823930 CTGGGGATCGGAGGGGGGGGGGG - Intergenic
1168120190 19:54247675-54247697 CTGGGGAAGGGAGGGTTGTAAGG - Intronic
1168432564 19:56293076-56293098 GTGGGGTTTGGAGGTGGGTGTGG - Intronic
1168434729 19:56308008-56308030 CAGGGGATGGAATGTGGGTGGGG - Intronic
925713072 2:6760403-6760425 GTGTGGATGTGATGTGTGTGTGG + Intergenic
925924484 2:8660267-8660289 CTGGGAACAGCAGGTGTGTGTGG + Intergenic
926234103 2:11026479-11026501 ATGTGGATGGGAGGAGTCTGCGG - Intergenic
927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG + Intergenic
927554082 2:24020439-24020461 CTGGGGAGGGGAGGAGAGGGAGG - Intronic
927962757 2:27250878-27250900 CTGGGCCTGGGAGGGGTGAGGGG - Intergenic
928011877 2:27616744-27616766 CTCGGGATGGGAGGTGGGATAGG + Intronic
928191174 2:29169914-29169936 CAAAGGCTGGGAGGTGTGTGTGG - Intronic
928557479 2:32442899-32442921 CTGGGGAGGGGAGGGGTCTTGGG - Intronic
929426734 2:41851670-41851692 CTGGGGATGGGAGGTGGAGCTGG - Intergenic
929429434 2:41874676-41874698 CTGCGGGTGGGAGGTGAGAGTGG - Intergenic
929472559 2:42210031-42210053 AAGGGAATGGGGGGTGTGTGTGG - Intronic
930053982 2:47238078-47238100 CGGGGGAGGGTATGTGTGTGTGG - Intergenic
930683269 2:54280350-54280372 TTGGGTAAGGGAGGTGTGGGTGG + Intronic
931580533 2:63767001-63767023 CTGGGGATGGGGTGAGGGTGGGG - Intronic
931709434 2:64975464-64975486 CTGGGCATGGGAGGAGGGTGTGG + Intergenic
931794998 2:65700500-65700522 CTGGGGGTGGGGGGGCTGTGAGG - Intergenic
931807699 2:65823713-65823735 CTGGGAGTGGAATGTGTGTGAGG + Intergenic
931925791 2:67071155-67071177 CTGGGGATGGCAGGTAGGTGGGG - Intergenic
932454157 2:71835578-71835600 ATGGGAATGGGAAGTGTGTTAGG - Intergenic
932620915 2:73264564-73264586 CTGGTGTGGGGATGTGTGTGGGG + Intronic
932836061 2:75038659-75038681 CTGGGGATGGAAGGGTTGAGTGG + Intergenic
933609844 2:84422420-84422442 CTGGGGAGGGGATGTGAGTTGGG - Intergenic
933699405 2:85243881-85243903 CTGGGGGTGGGAGATGTGGTGGG + Intronic
934514958 2:94980826-94980848 CTGGGCAGGGCAGGTCTGTGGGG + Intergenic
934733329 2:96673042-96673064 CTGGGTATGGGGGGTGGGGGCGG + Intergenic
934768674 2:96894626-96894648 CTGTGGGTGGGGGGTCTGTGGGG - Intronic
934925626 2:98380110-98380132 CTGGGGTTTGGGGGTGTGGGGGG + Intronic
934948875 2:98562842-98562864 CTGGGGAAGGAAGGTGGGGGTGG + Intronic
935064840 2:99638522-99638544 CAGGGGAGGGGTGGTGGGTGGGG + Intronic
935081453 2:99800912-99800934 CTGGGGATGAGTGGGGTGTGTGG + Intronic
935306784 2:101744588-101744610 CTTGGGTTGGGGGGTGTGTGAGG + Intronic
935568642 2:104635920-104635942 CTGGGGATGGTAGGTGGGGCAGG - Intergenic
935710281 2:105892600-105892622 CTGAGGCTGGGAGGGGGGTGGGG + Intronic
935980961 2:108626522-108626544 ATGGGGGTGGGAGGTGAGAGTGG - Intronic
937295544 2:120807850-120807872 CGGGGGCGGGGAGGTGTGTGGGG - Intronic
937825589 2:126365400-126365422 GAGGGGATGGGGTGTGTGTGTGG + Intergenic
937906040 2:127053301-127053323 CTGCGTGTGGGGGGTGTGTGGGG + Intronic
938101325 2:128499884-128499906 CCAAGGTTGGGAGGTGTGTGTGG + Intergenic
938271736 2:129978118-129978140 CTGGGGACTACAGGTGTGTGTGG + Intergenic
938680656 2:133686621-133686643 CTAGAAATGGGAGGTGTTTGTGG - Intergenic
939902791 2:147870081-147870103 GGGGGGATGTGAGGTATGTGGGG + Intronic
940368476 2:152875267-152875289 CTGGGCTTAGGAGGTGGGTGTGG - Intergenic
940920916 2:159305653-159305675 CTGGGGATGGATGGTGGTTGTGG + Intergenic
943667831 2:190628655-190628677 CTGGGGATGGGCAGTGTTTGGGG + Intergenic
943995459 2:194759609-194759631 CTTTGGATGTGAGGTCTGTGGGG - Intergenic
944110249 2:196124230-196124252 CTGGAGAGGGGAATTGTGTGGGG + Intergenic
944881709 2:204019267-204019289 GTGGGGGTGGTAGGTGGGTGTGG + Intergenic
945291600 2:208132921-208132943 TTGGGGGTGGGAGGTGGTTGGGG - Intergenic
946055161 2:216894825-216894847 CTTGGGATGGGAGCTGTTTTGGG + Intergenic
946173254 2:217907794-217907816 CTTGGAAATGGAGGTGTGTGAGG - Intronic
946355657 2:219182711-219182733 CTGGGGTGGGGCAGTGTGTGGGG + Exonic
946364161 2:219238201-219238223 CTGGGGAAGGGAGGAGTTTGGGG + Intronic
946783590 2:223219120-223219142 CTGGGGAAGGGAGGAATGTTTGG - Intergenic
947698750 2:232215312-232215334 GTGGGGATGGGAAATGTGAGCGG - Intronic
947856642 2:233328665-233328687 CTGGTGAAGAGAGGGGTGTGGGG - Intronic
948263686 2:236622447-236622469 CTGGGGGTGGGAGGCCTGGGAGG + Intergenic
948323620 2:237092902-237092924 CTGGAGATGCTAGGTGTTTGGGG + Intronic
948467365 2:238158845-238158867 ATGGGGATGGGGGGAGTGTCCGG - Intergenic
948513181 2:238487048-238487070 GTGTGGAGGGGGGGTGTGTGTGG - Intergenic
948802676 2:240440008-240440030 CCGGGGATGGGATGGGGGTGGGG - Intronic
948893360 2:240917398-240917420 CTGGGGTTGGGAGGAGGGTGGGG + Intergenic
949007582 2:241658410-241658432 CTGTGGAGGGGAGCTGGGTGGGG - Intronic
1169141820 20:3230902-3230924 CTGGCGGTGGGCGGTGGGTGGGG - Intronic
1169207397 20:3748194-3748216 CTGGGGATGGGTGGTGGGCAGGG - Intronic
1169250500 20:4057311-4057333 CTAGGGATGAGAGGTGGGAGGGG - Intergenic
1169465843 20:5837459-5837481 TTGGAGGTGGGGGGTGTGTGGGG - Intronic
1170113812 20:12835567-12835589 CTGGAGATGGGAAGTCTGTATGG - Intergenic
1170194838 20:13679408-13679430 CTGGTGGTGGGAGGTGGGGGTGG + Intergenic
1170428531 20:16258237-16258259 TTGGGGATGGGGTGTGTGTTTGG - Intergenic
1170473141 20:16688248-16688270 CTGGGGTTGGGAGAGGTGTTTGG + Intergenic
1170524212 20:17221457-17221479 CTGAGGATGGGTGGTGTGAAGGG + Intergenic
1170774922 20:19366843-19366865 CTGGGGGTGGGAGGTGGGAATGG - Intronic
1170795307 20:19541787-19541809 TCGGGGTTGGGCGGTGTGTGCGG + Intronic
1171127313 20:22613789-22613811 GAGGGGATGAGAGGTGTTTGAGG - Intergenic
1171251571 20:23653082-23653104 CTGGGCCTGGGTCGTGTGTGGGG - Intergenic
1171355127 20:24538259-24538281 CAGGGGATGGGAGTGGTGTGAGG - Intronic
1171795653 20:29564236-29564258 CGGAGGATGTGAGGTGGGTGGGG + Intergenic
1171852778 20:30320225-30320247 CAGAGGATGTGAGGTGGGTGGGG - Intergenic
1172106842 20:32522093-32522115 CTGGGGAGTGGAGTTGTGGGGGG + Intronic
1172881179 20:38200944-38200966 CTGGGGTTGGGAAGTCTGTGGGG - Intergenic
1173333919 20:42098025-42098047 AGGGGGAAGGGAGGTGAGTGTGG + Intronic
1173993151 20:47318406-47318428 CTGGGGAAGGGAGGCCTGTTTGG - Intronic
1174308354 20:49631373-49631395 CTGGGGGTGGGAGGTGAGGTGGG - Intergenic
1174321054 20:49741950-49741972 CAGGGGCTGGGAGGCGTGTCAGG - Intergenic
1174485125 20:50856101-50856123 CAGGGGATGGCAGGTGTGATCGG + Intronic
1174540047 20:51282159-51282181 TTGGGGAAGGCAGGTGTGGGAGG - Intergenic
1175172626 20:57091063-57091085 GTGTGCATGGGTGGTGTGTGTGG - Intergenic
1175172644 20:57091149-57091171 GTGTGCATGGGTGGTGTGTGTGG - Intergenic
1175327709 20:58141271-58141293 CTGGGGTAGGGAGCTGTTTGGGG + Intergenic
1175625670 20:60486638-60486660 CTGGGGAAGGGAAGTGTTTAGGG + Intergenic
1175669528 20:60890102-60890124 CTGGGCTTGGGGGGTGTGTGGGG - Intergenic
1175789480 20:61732466-61732488 CTGAGGATGGGAGGAGACTGGGG - Intronic
1175800680 20:61799634-61799656 CTGGGGATAGGAGGGGTGCTGGG + Intronic
1175806042 20:61829919-61829941 CTGGGGCTGGGAGGCAGGTGTGG + Intronic
1175902169 20:62364268-62364290 CTGGAGAAGGTAGGTGTGGGCGG + Intronic
1176137444 20:63530417-63530439 CCTGGGATTGCAGGTGTGTGGGG + Intronic
1176514450 21:7773785-7773807 CTGGTGATGGGGGCTGGGTGTGG + Intergenic
1176669401 21:9718272-9718294 CTGGGGATGGTGGGGGAGTGAGG + Intergenic
1176740044 21:10593138-10593160 GTGGGGTTGGGGGGTGTGAGTGG - Intronic
1177012490 21:15745125-15745147 CGGGGGGAGGGAGGTGTGGGAGG + Intronic
1177321878 21:19533063-19533085 ATGGGGTGGGTAGGTGTGTGGGG - Intergenic
1178648563 21:34404309-34404331 CTGGTGATGGGGGCTGGGTGTGG + Intronic
1179929134 21:44555659-44555681 AGGGGGGTGGGATGTGTGTGTGG - Intronic
1180004078 21:45011981-45012003 CTGGGGTCGGGCGGGGTGTGGGG - Intergenic
1180155570 21:45975598-45975620 CTGGGGTTGGGAGTTCCGTGTGG + Intergenic
1180225822 21:46391513-46391535 CTGGGCATGGGAAGCTTGTGCGG + Intronic
1180655798 22:17419382-17419404 CTGGGGATTGGAGGAGGTTGTGG + Intronic
1180790681 22:18573987-18574009 GTGGGGATGGGAGCTCTGTGTGG - Intergenic
1181027369 22:20133804-20133826 CAGGAGATGGGGGGTGTGTGGGG - Intronic
1181231056 22:21421327-21421349 GTGGGGATGGGAGCTCTGTGTGG + Intronic
1181247592 22:21513541-21513563 GTGGGGATGGGAGCTCTGTGTGG - Intergenic
1181305602 22:21915772-21915794 CTGGGGCTGGGCAGTGAGTGAGG + Intergenic
1181506474 22:23361741-23361763 CTGGTGATGGAAGGGGTGGGTGG - Intergenic
1181568305 22:23752648-23752670 CTGGGGTGGGGAGCAGTGTGCGG - Intergenic
1181820933 22:25475149-25475171 TTGAGCATGGGAGGTGTGAGTGG + Intergenic
1182134362 22:27887550-27887572 CTGGGGAGGTGGGGTGGGTGGGG - Intronic
1182957614 22:34442066-34442088 CTGGGGATGAAATGTGAGTGTGG - Intergenic
1183314500 22:37129461-37129483 CTGGGGATGGGAGGCGGAGGGGG - Intronic
1183419993 22:37706162-37706184 CTTGGGTTGGGAGGTCTGTTTGG + Intronic
1183505465 22:38206245-38206267 CTGGGAATTGGTGCTGTGTGTGG + Intronic
1183590958 22:38779070-38779092 CTGGGGATGGCAGGGCAGTGGGG + Exonic
1183723276 22:39574469-39574491 CTTGGGATGGGGTGCGTGTGTGG + Intronic
1183933015 22:41246823-41246845 GTGGGGATGGGAGGTGCGAGAGG + Intronic
1184265724 22:43344784-43344806 ATGGGGATCGGGGGTGTGGGGGG + Intergenic
1184271586 22:43387499-43387521 CTGATGAAGGGAGGTGGGTGGGG + Intergenic
1184493349 22:44823284-44823306 CTGGGGAGGGGACTGGTGTGTGG + Intronic
1184659680 22:45960129-45960151 CTGGGGCTGGGAGGTGGCTCAGG - Intronic
1184776619 22:46626591-46626613 GTGGGGCTTGGAGGTGTGTGTGG + Intronic
1184840207 22:47048179-47048201 CTGCTGCTGAGAGGTGTGTGTGG + Intronic
1185136495 22:49076300-49076322 CTGGGGATGGTAAGCGTGGGAGG + Intergenic
1185285818 22:49999590-49999612 GCGGGGACGGGAGGTGGGTGGGG + Intronic
1185409357 22:50674231-50674253 GTGGGGGCGGGAGGTGTGTGCGG - Intergenic
949999756 3:9647901-9647923 CTGGGGGTGGGAGGAGTTGGGGG + Intergenic
950534652 3:13571849-13571871 CTTGGGATGGGATGGGTGGGTGG + Intronic
950704322 3:14770552-14770574 CTGGGGACAGGAAGTGGGTGTGG - Intronic
950786700 3:15442976-15442998 CTGGGAGTCAGAGGTGTGTGTGG - Intronic
951432357 3:22622902-22622924 TTGGGGGTGGCAGGTGTGTGGGG - Intergenic
952230083 3:31420527-31420549 CTGGCCAAGGGAGGTGAGTGAGG - Intergenic
952701430 3:36332320-36332342 CTGGAGATGGGATGTGGTTGAGG - Intergenic
952959349 3:38579901-38579923 CTGGGTGTGTGTGGTGTGTGTGG - Intronic
953019042 3:39102596-39102618 CTGGGTGTGGGCGGGGTGTGAGG - Intronic
953053329 3:39366231-39366253 TTGGGGGTGGGAGGTGGGGGAGG + Intergenic
953351411 3:42219194-42219216 CTGGGGGTGGGAGGCGAGGGGGG - Intronic
953406703 3:42663357-42663379 CTCAGGGTGGGAAGTGTGTGTGG + Intronic
953627082 3:44580155-44580177 CTGGGGCTGGGAGGGGAGAGCGG + Intronic
953688688 3:45098643-45098665 ATGGGAATGGGAAGTGTGTGTGG - Intronic
953786825 3:45917309-45917331 GTGGGGGTGTGAGGTGAGTGTGG + Intergenic
953796810 3:45992233-45992255 CTGGGGAGGGGAGGTGCTGGTGG + Intronic
954055824 3:48023846-48023868 CTGGGGATGGCAGGGGTTGGGGG + Intronic
954215666 3:49123043-49123065 CTGTGCCTGGCAGGTGTGTGGGG - Exonic
954445286 3:50543012-50543034 GTGGAGCTGGGAGGTGGGTGCGG + Intergenic
954666303 3:52254759-52254781 TTGGGGATGGGTGGGGAGTGGGG - Exonic
954767748 3:52935519-52935541 TTGGGCATGGGTGGAGTGTGAGG - Intronic
954848144 3:53577711-53577733 CTGGAGATGTGAGGGCTGTGAGG + Intronic
954854086 3:53627603-53627625 CTGTGGATGGGTGGGGGGTGGGG + Intronic
955102701 3:55867297-55867319 CTGTGTGTGGGAGGTGGGTGTGG - Intronic
955195577 3:56802076-56802098 CTGGGGCTGCGAGGGGCGTGGGG + Intronic
955562742 3:60209931-60209953 TTGGGGGTGGAGGGTGTGTGGGG + Intronic
956733126 3:72214883-72214905 GTGGGGGTGGGAGGTTTTTGAGG - Intergenic
956991506 3:74771725-74771747 ATGGGGAAGGGAGGAGAGTGGGG + Intergenic
958089977 3:88865064-88865086 CTGGGGATGTGAGAGGTGGGAGG - Intergenic
958093030 3:88902353-88902375 CGGGGGTTGGGAGGTGTGGGGGG - Intergenic
959284219 3:104386888-104386910 CTAGGGATAGGAGGTAGGTGAGG + Intergenic
959570365 3:107876578-107876600 CTGGGGCTGGGAGCTGGGTGGGG + Intergenic
959630863 3:108506092-108506114 TTGGGGTTGGGAGGGGTGTTGGG - Intronic
959636792 3:108583602-108583624 GTGGTGATGGGAGGTGTGAGGGG + Intronic
960240962 3:115341478-115341500 CTGGGGGTGGGAGCTGCTTGGGG + Intergenic
961141781 3:124562276-124562298 GTGGGGATGGGAGGTGTTGCAGG + Intronic
961456275 3:127026092-127026114 GTGGGGCTGGGAGGAGTCTGAGG + Intronic
961524447 3:127487658-127487680 CAAGGGAGGGGAGGTGTGAGGGG - Intergenic
962143019 3:132810471-132810493 CTGGAGATGGGGTGTGGGTGAGG - Intergenic
962468606 3:135684886-135684908 CTGGGGAGGGTAGTTGGGTGGGG + Intergenic
962736272 3:138328344-138328366 CTGGGGGTGGGAGGGGTGTGGGG - Intronic
964570323 3:158103333-158103355 CTGGGAATGGCCGGTGTGAGAGG - Intronic
964912023 3:161794637-161794659 CTGGGGAGGGGAGGAGTGGAGGG - Intergenic
965540409 3:169865915-169865937 CTGGGGATGGGAGAAGAATGTGG + Intronic
965597252 3:170421145-170421167 CTGGGGGTGGGGGGGGGGTGGGG + Intronic
965607990 3:170515605-170515627 CTGGGGTTAGGATGTGTGTTGGG + Intronic
966190469 3:177267836-177267858 CAGAGGTTGGGAGGTGGGTGAGG - Intergenic
967301559 3:188019397-188019419 CTGAGGATGAAAGGTGGGTGGGG + Intergenic
967318048 3:188168965-188168987 CTTGGGATGGGAGGTGGGGGAGG - Intronic
967765541 3:193275370-193275392 CTGGGGAAAGGAGGTGGCTGTGG - Intronic
968033850 3:195528146-195528168 TTGGGGATGGGAGGGGTGAGAGG - Intronic
968263388 3:197343235-197343257 CTGAGGAAGGGAGGACTGTGAGG - Intergenic
968454122 4:688649-688671 CTGGGGCTGGGAGGCGTGGAAGG + Intronic
968563484 4:1296985-1297007 CTGGGGAGGGCAGCAGTGTGGGG - Intronic
968591737 4:1463006-1463028 GTGGGGAGTGCAGGTGTGTGTGG + Intergenic
968640235 4:1711165-1711187 TTGGGGATGGGAGGCGTGAAAGG - Intronic
968771732 4:2511807-2511829 CTGTGGGTGGGAGGAGGGTGGGG + Intronic
969352019 4:6603530-6603552 GTGGGGAAGGGGTGTGTGTGGGG - Intronic
969704186 4:8783079-8783101 CCGGGGATGGGAGGTGCGATTGG + Intergenic
970636862 4:18020715-18020737 ATGGGGATGGGAGGTGGGGAGGG + Intronic
970967761 4:21948412-21948434 CTGGGAAGGGGAGGTGGGAGCGG - Intronic
971954153 4:33394283-33394305 TGGGGGGTGGGGGGTGTGTGGGG + Intergenic
971955745 4:33416367-33416389 GGGGGGTTGGGAGGTGTGAGGGG - Intergenic
972096809 4:35358147-35358169 ATGGGGATGGGAGGTTTGTGTGG - Intergenic
972169749 4:36331594-36331616 GTGGGAATGGGAGGAGTGTGAGG + Intronic
972276838 4:37565498-37565520 CTGGGGGAGGAAGGTGTCTGTGG - Intronic
972594143 4:40515534-40515556 TTGGGGATTGGAGGAGTGGGTGG - Intronic
973060211 4:45715014-45715036 CTGGGGATGGGAGGTAGTGGTGG + Intergenic
973567140 4:52199850-52199872 GTGGGGGTGTGTGGTGTGTGTGG + Intergenic
973567145 4:52199869-52199891 GTGGGGGTGTGTGGTGTGTGTGG + Intergenic
973712203 4:53641192-53641214 CTGGGGAAGGGCGGGGTGGGGGG + Intronic
975493733 4:75015409-75015431 CTGGGGAAGAGAGGTGTGGCCGG + Intronic
975826565 4:78326008-78326030 CTGGAGATGCAGGGTGTGTGTGG + Intronic
975983426 4:80183684-80183706 GTGGTGTGGGGAGGTGTGTGAGG - Intergenic
975986863 4:80208115-80208137 GTGGGTATGTGATGTGTGTGTGG - Intergenic
976258641 4:83124856-83124878 GAGGGGAGGGGAGGGGTGTGGGG + Intronic
976450285 4:85181685-85181707 CGGGGGATGGGAGGGGGGTGAGG - Intergenic
977300742 4:95264581-95264603 CTGGGGAGGGTGGGTGTGTCAGG - Intronic
977865979 4:102028130-102028152 GTTGGGAAGGGAGGTGGGTGGGG + Intronic
977959091 4:103064488-103064510 CTGGGGAGGGGAGGAGCTTGGGG + Intronic
978801518 4:112760111-112760133 CTGGGGTGGGCAGGTGGGTGGGG - Intergenic
980794472 4:137663175-137663197 GTGGGGATGGGCAGTGGGTGGGG - Intergenic
981045053 4:140257039-140257061 CTGGGGAGGGGAGGTGGAGGAGG - Intergenic
981150570 4:141376082-141376104 CTGGGGAGGGGAGGTAAGGGAGG + Intergenic
981356800 4:143798763-143798785 CTGGGTTTGGGACTTGTGTGGGG - Intergenic
981937253 4:150250892-150250914 GTGGGGATGTGGGGGGTGTGGGG - Intronic
981937428 4:150251383-150251405 TGGGGGGTGTGAGGTGTGTGGGG - Intronic
981937438 4:150251409-150251431 CGGGGGATGTGGGTTGTGTGGGG - Intronic
982000223 4:151015370-151015392 AAGGGGTGGGGAGGTGTGTGTGG + Intronic
982868252 4:160544309-160544331 CTGGAGATGGGATTTGGGTGGGG + Intergenic
984420637 4:179516289-179516311 CTGTGGATGTGAGGTTTGAGAGG - Intergenic
984658160 4:182342456-182342478 CTGGGGGTGGGAGGGGTGAGGGG + Intronic
985405369 4:189633196-189633218 CTGGGGATGGTGGGGGAGTGAGG - Intergenic
985607401 5:865382-865404 CTGGGGATGCGGCGTGGGTGGGG + Intronic
986270682 5:6228185-6228207 CTGGGCAAAGGAGGGGTGTGCGG - Intergenic
986793075 5:11182142-11182164 GTGTGGATGGGGTGTGTGTGTGG + Intronic
987067340 5:14303054-14303076 CTGGAGATGGGGGGTGTCAGTGG + Intronic
987067358 5:14303126-14303148 CTGGAGATGGGGGGTGTCAGTGG + Intronic
987067375 5:14303198-14303220 CTGGAGATGGGGGGTGTCAGTGG + Intronic
987235881 5:15941245-15941267 CTGTGGTAGGGAGGGGTGTGGGG + Intergenic
987372286 5:17204202-17204224 TTGGGGATGGGAGTGGTGTGTGG - Intronic
988081044 5:26416076-26416098 GTGGAGAGGCGAGGTGTGTGTGG + Intergenic
988171368 5:27661014-27661036 ATGGTAATGGGAGGTTTGTGGGG - Intergenic
989164620 5:38422298-38422320 ATGGGGAGGAGAGGTGGGTGTGG - Intronic
989550215 5:42726336-42726358 CTGGGGATGGGAAGTGGGGAAGG - Intergenic
989576061 5:42989957-42989979 CTGGTGATGGCAGTTTTGTGTGG - Intergenic
990200997 5:53374166-53374188 CGGAGGGTGGGAGGAGTGTGAGG + Intergenic
990278820 5:54228165-54228187 TTAGGGATGTGAGATGTGTGAGG - Intronic
990486370 5:56262965-56262987 CTGGGGATGGGATGAGAGGGTGG + Intergenic
991700613 5:69313211-69313233 CAGGGGGTGGGAGGTCTGTTTGG + Intronic
992365794 5:76088069-76088091 CTGGGGATGGAAGTGGTTTGGGG - Intronic
992630529 5:78675835-78675857 CTGAGGAGGGGATGTGGGTGGGG + Intronic
992672971 5:79077896-79077918 GTGTGGATGTGGGGTGTGTGTGG - Intronic
993723036 5:91340587-91340609 TTGGGAATGGGAGGTGGCTGGGG - Intergenic
994612738 5:102065366-102065388 TTGGGGAAAGGAGGAGTGTGGGG + Intergenic
995183887 5:109252356-109252378 CTGGGGGTGGGAGGGCAGTGTGG + Intergenic
995758862 5:115543805-115543827 TTGGGGGTGGGGGGGGTGTGTGG - Intronic
996597528 5:125222687-125222709 CCAGGGATGGGAGGTGGGGGTGG - Intergenic
996920375 5:128761133-128761155 TTGAGGATGGGAGGGGTGGGAGG + Intronic
997260973 5:132465341-132465363 CTGGGGGTAGGAGCTGTGGGCGG - Intronic
997286690 5:132684642-132684664 CTGTGGGTGGGAGGCGGGTGTGG + Intergenic
997618946 5:135272449-135272471 CTGGGGATGGGAGCATGGTGGGG + Intronic
997887523 5:137643879-137643901 CTGGGGAAGGGAGGAGGGAGGGG - Intronic
998006912 5:138663158-138663180 CTGGAGATAGGAGGGGTGAGTGG - Intronic
998103311 5:139451903-139451925 CTGTGGATGTGTGGTGTATGGGG + Intronic
998131379 5:139653124-139653146 CTGGGGAGGGAAGGGGTGTAGGG - Intronic
998385983 5:141757498-141757520 CTGGGGGTGGGAGGTGGGGAGGG - Intergenic
998706023 5:144761842-144761864 TGGGGGATGGGAGGTGGGGGAGG - Intergenic
998913659 5:146991415-146991437 CTAGGGATGGGAGGCGGGAGAGG + Intronic
999300526 5:150487221-150487243 ATGAGGATGAGAGGAGTGTGTGG + Intronic
999600388 5:153256197-153256219 TTGGGGATTGGAGGTATGAGCGG + Intergenic
999768454 5:154757066-154757088 CTGGGGGTGGCAGGAGGGTGCGG + Intronic
1000153737 5:158529819-158529841 CTGGGCATGTTAGGTGTGGGAGG + Intergenic
1000667166 5:164012937-164012959 CTGGGGCAAGGAGGTGGGTGGGG + Intergenic
1000759664 5:165206673-165206695 CTGGGAAAGAGAAGTGTGTGGGG + Intergenic
1001430741 5:171660034-171660056 CTGGGGATGGGGGGTGGGGAAGG - Intergenic
1001503477 5:172257126-172257148 CAGAGGATGGGAGGAGGGTGAGG - Intronic
1001546316 5:172572695-172572717 CTGGGGAGGGGTGTTGTATGAGG + Intergenic
1001640456 5:173240262-173240284 CTGGGGAGGGGTGGGGGGTGAGG - Intergenic
1001650155 5:173310286-173310308 CTGGAGAAGGGAGGTCTGAGCGG + Intergenic
1002307760 5:178293760-178293782 CTGGAGATGGAAGGGTTGTGGGG + Intronic
1002440844 5:179263554-179263576 TTTGGGATGGGAGGCGTGGGAGG + Intronic
1002704597 5:181151718-181151740 CTGGGGCTGGGAGGGGCGTCTGG + Intergenic
1002882511 6:1265407-1265429 CTGGGTAGGGGAAGTCTGTGGGG + Intergenic
1002897443 6:1388024-1388046 GTGGGGAGGGGAGGGGTATGTGG - Intergenic
1002916272 6:1530330-1530352 CTGGGCAGGGGAGCTGTTTGGGG - Intergenic
1002947368 6:1775944-1775966 AGGGAGATGGGAGGTATGTGGGG + Intronic
1002980295 6:2129265-2129287 GTTGGGATGGGGTGTGTGTGGGG - Intronic
1003030193 6:2594746-2594768 CTGGGGATGGGCAGTTTCTGAGG - Intergenic
1003364226 6:5457241-5457263 ATAGGGGTGGGAGGTGGGTGTGG - Intronic
1003403556 6:5810168-5810190 GTGGGGCTGGGAGGTGGGCGTGG + Intergenic
1004016512 6:11736871-11736893 CTGAGGGTGGTAAGTGTGTGGGG + Intronic
1004110817 6:12716959-12716981 CCGGGGATGGGGGTTGTGGGGGG + Intronic
1004407215 6:15344354-15344376 CTTGGGATGTGGAGTGTGTGTGG + Intronic
1004468266 6:15905768-15905790 CTGGGGATGGGAACTGGTTGCGG + Intergenic
1004918795 6:20357079-20357101 ACGGGGGTGGGAGGTGTGTTGGG + Intergenic
1006256685 6:32838082-32838104 CTGCGGCTGGGAGGGCTGTGGGG - Exonic
1006377307 6:33678578-33678600 CGGGGGATGGGGGGTGGGGGCGG + Intronic
1006389403 6:33749658-33749680 CCGGGAATGGGAGGTGTGAGGGG + Intergenic
1006389772 6:33751526-33751548 CCGGGAATGGGAGGTGTGAGGGG + Intergenic
1006460310 6:34154253-34154275 GCGGTGAGGGGAGGTGTGTGCGG - Intronic
1006565283 6:34950780-34950802 ATGGGGGTGGGTGGTGGGTGAGG + Intronic
1006568827 6:34983374-34983396 CTGGAGATGAGAGGTGGCTGGGG - Exonic
1006734183 6:36260828-36260850 CTGGGGCAGGGAGGAGGGTGCGG + Intronic
1006856527 6:37137555-37137577 GTGGGGTTGGGAGGTGGGAGCGG - Intergenic
1007095327 6:39209392-39209414 CTGGGGATGGATGGTGGGCGGGG - Intronic
1007228374 6:40330458-40330480 CTGGGGGTGGGAGGTGGGGGCGG + Intergenic
1007323126 6:41041341-41041363 GTGGGGCTGGGAGGAGGGTGGGG - Intronic
1007324618 6:41050403-41050425 CTGGGCCTGGGAAGTGTGAGAGG + Intronic
1007407888 6:41645258-41645280 TGGGGGATGGGAGGTGAGGGAGG - Intronic
1007466719 6:42057445-42057467 CTGGGGATGTGCGGCGGGTGGGG - Exonic
1007719988 6:43879199-43879221 CTGGGGCTGGGGTGTGTGTAGGG - Intergenic
1007762444 6:44140954-44140976 CAGGGGATGTGAGGGGTGGGGGG - Intronic
1008022869 6:46600546-46600568 CTGGGGAAGGGAGGTGGGCTGGG + Intronic
1008033662 6:46723982-46724004 GTGGGGATGGAAGGTGGGTGTGG - Intronic
1008540028 6:52538367-52538389 GTGGGCATAGGATGTGTGTGGGG + Intronic
1008605299 6:53133862-53133884 CTGGGTATGGCAGATATGTGGGG + Intronic
1009036366 6:58121468-58121490 CTGGGGGTGGTAGGGGTGGGGGG - Intergenic
1009619781 6:66060405-66060427 CTAGGGATGGGTTGTATGTGTGG + Intergenic
1009734436 6:67658828-67658850 CTGAGGGTGGGAGGTGGGAGAGG - Intergenic
1010146537 6:72676240-72676262 CTAGGAATGGGAGAAGTGTGTGG + Intronic
1010355108 6:74923166-74923188 CTGGGGAATGGAGTTGGGTGTGG - Intergenic
1010902320 6:81442530-81442552 CTGTGGGTGGCATGTGTGTGTGG + Intergenic
1011000469 6:82582883-82582905 GGGGGCATGGGAGGTGAGTGTGG - Intergenic
1012448511 6:99330882-99330904 CAGAGGATGGGAGGTGCCTGAGG + Intronic
1012546361 6:100424057-100424079 CGGGGGGTGGGAGGGGGGTGGGG - Intronic
1012698695 6:102423405-102423427 CAGAGGATGGGAGGAGAGTGAGG + Intergenic
1013046308 6:106488936-106488958 CTGGGGATGGGAGGTGTCAAGGG + Intergenic
1013091808 6:106906919-106906941 CTGTGGCTGGGTGGTCTGTGAGG + Intergenic
1013209583 6:107974543-107974565 CTGGGGATGGGAGTTGGGGTGGG + Intergenic
1013369516 6:109456542-109456564 TGGGGAATGGGAGGGGTGTGTGG + Intergenic
1013836434 6:114341635-114341657 GTGGGGCTGTGAGGGGTGTGGGG + Intronic
1014205931 6:118655322-118655344 CTTGGGATAGGAAGTGGGTGTGG + Intronic
1014216278 6:118755536-118755558 CTGGGGAAGGAAGGCCTGTGTGG - Intergenic
1015245740 6:131072600-131072622 CTGGGGGTGAGAGGTGAGGGTGG + Intergenic
1015374372 6:132492917-132492939 CTGGGCATGGGAGGAGAGTGGGG - Intronic
1015384909 6:132610837-132610859 TTGGTGATGGGAGGTGTGCAGGG + Intergenic
1015481172 6:133711625-133711647 CTAGGGATGGGAGCTGAGGGGGG - Intergenic
1015818734 6:137237542-137237564 CTGGGGTGGGGAAGTGGGTGAGG + Intergenic
1016257219 6:142122010-142122032 CTGGGAATGAGAGGCATGTGGGG - Intergenic
1017019186 6:150126814-150126836 GTGGGAATGGCAGGGGTGTGTGG + Intergenic
1017882919 6:158573903-158573925 ATGGGGAGGGGAGGAGAGTGGGG + Intronic
1017903014 6:158734525-158734547 CTGGAGGTGGGATGTGTCTGGGG - Intronic
1018027256 6:159816159-159816181 GGGGGGAGGGGAGGGGTGTGGGG - Intronic
1019057978 6:169236558-169236580 GTGTGGATGGGAAGTGAGTGTGG - Intronic
1019304293 7:325553-325575 CTGGGGCCAGGAGGTGTGTGGGG - Intergenic
1019335697 7:481571-481593 GTGGGGAGGGGAGGAGTGTGGGG - Intergenic
1019335720 7:481625-481647 TTGGGGAGGGGAGGAGGGTGGGG - Intergenic
1019345248 7:526590-526612 TTGGGGATGGGAGGGGTTTGCGG - Intergenic
1019982772 7:4633671-4633693 CTGGGTAGGGGAGGTGGGCGGGG - Intergenic
1020212719 7:6167893-6167915 CTCTGCATGGGAGGTGTGAGCGG - Intronic
1020214545 7:6179738-6179760 GTGGGGGTGTGGGGTGTGTGTGG - Intronic
1021277854 7:18677135-18677157 CTGGGGCTGGGAGGAGAGTGAGG - Intronic
1021489286 7:21201090-21201112 CTGGGCGGGGGAGGTATGTGCGG + Intergenic
1021496089 7:21276238-21276260 CTGGGGAGGGGAGGAGGCTGGGG - Intergenic
1021771688 7:24009111-24009133 CAGGGGATGGGGGGTGGGGGGGG - Intergenic
1022043141 7:26599794-26599816 CTGGGGAGGGGAGGTGTGTGAGG + Intergenic
1022528821 7:31054306-31054328 GTGGTGAGGGGAGGTGTCTGTGG + Intronic
1022589342 7:31646352-31646374 CTGGGGATTGAAAGTGTGAGTGG + Intronic
1023079690 7:36515308-36515330 GTGGGGTTGTGAGGGGTGTGGGG - Intronic
1023590268 7:41774028-41774050 TTGGGGGTGGGAGGTGGGAGAGG + Intergenic
1023630276 7:42156814-42156836 CTGGTGATGGGAGGAGGGTGTGG - Intronic
1023844037 7:44111262-44111284 CTGGGGGTGGGACCTGTCTGTGG + Intronic
1023881374 7:44323460-44323482 CTGGGGAATGGAGGTCTTTGGGG - Intronic
1024519292 7:50290030-50290052 CAGGGGATGGGGGGATTGTGGGG - Intergenic
1024765411 7:52652214-52652236 TTTGGGATGGGAGATTTGTGAGG + Intergenic
1024891543 7:54210162-54210184 CTGTGGCTGGGAGGTGGGTGAGG - Intergenic
1024984288 7:55182134-55182156 ATGGAGATGGGAGGGGTTTGGGG - Intronic
1026501160 7:70944535-70944557 TTGAGGATGGCTGGTGTGTGGGG - Intergenic
1026671063 7:72391144-72391166 CTGCGGTTGGGAGGTGGGTAGGG - Intronic
1026858180 7:73768734-73768756 CTGGGGATGGGAGGGGAAGGTGG - Intergenic
1026955261 7:74372726-74372748 CTGGGGAGGCGAGGGGTGTGGGG - Intronic
1027269773 7:76513061-76513083 CTGGGGATGGGAGGTGGTGGGGG - Intronic
1027320484 7:77006956-77006978 CTGGGGATGGGAGGTGGTGGGGG - Intergenic
1027389799 7:77693479-77693501 TTGGGGATGGGAGGAGAATGGGG + Intergenic
1028020149 7:85760655-85760677 GTGAGGGTGGGAGGTGGGTGAGG + Intergenic
1028963288 7:96773951-96773973 CTGGGGATGGGGAGTGGGGGTGG + Intergenic
1029115246 7:98233352-98233374 CTGGGGGTGTGGGGTGTGGGAGG - Intronic
1029576718 7:101408222-101408244 CTGGGGAAGGGAGGGGACTGAGG + Intronic
1029594164 7:101528056-101528078 CCGGGGATGGGGGTGGTGTGGGG + Intronic
1029595327 7:101534751-101534773 CTGGGGGTTGCAGGTGAGTGTGG + Intronic
1029675225 7:102064063-102064085 CTGGGTGTGGCAGGAGTGTGAGG + Intronic
1030197168 7:106863774-106863796 CTGGGGGTGGGTGGAGTGGGAGG - Intergenic
1030326668 7:108226983-108227005 CTGGGCTTGGGAGGCTTGTGAGG - Intronic
1031575314 7:123409361-123409383 CTGGGGGCAGGAGGAGTGTGTGG - Intergenic
1032194864 7:129782705-129782727 CTGGCGAAGGGAGCCGTGTGGGG - Intergenic
1033130333 7:138740514-138740536 CTGGGGTTGGGGGGTGGGGGTGG - Intronic
1033134773 7:138775256-138775278 GTGGGGAGGGGAAGTGGGTGGGG - Intronic
1033218044 7:139508359-139508381 CTGGGGAAGTGGGGTGTCTGGGG + Intergenic
1033401281 7:141027412-141027434 CTGGCTATGGGAGCTGGGTGAGG - Intergenic
1034068676 7:148161534-148161556 GTGTGTATGGGAGGTGGGTGAGG - Intronic
1034562109 7:151887066-151887088 CTGTGGATGGGAGGTTTGAAGGG + Intergenic
1034728740 7:153365195-153365217 CTGGGGTTTGGACTTGTGTGGGG - Intergenic
1035021574 7:155803879-155803901 TTGGGGGAGGGAGGTGTGTGCGG - Intronic
1035263701 7:157676974-157676996 CAGGGGAGGGGCGGTGTGCGTGG - Intronic
1035631341 8:1108952-1108974 CTGGGTCTGTGAGGTGTGTACGG + Intergenic
1035631403 8:1109474-1109496 CTGGGTCTGTGAGGTGTGTACGG + Intergenic
1035631432 8:1109715-1109737 CTGGGTCTGTGAGGTGTGTACGG + Intergenic
1035631461 8:1109956-1109978 CTGGGTCTGTGAGGTGTGTACGG + Intergenic
1035649285 8:1252996-1253018 CTGGTGCTGGGAGGCCTGTGGGG - Intergenic
1036621638 8:10427873-10427895 CTTGGGATGGCAGGGGTGTGGGG + Intronic
1036648613 8:10627537-10627559 CTGGGGATGGGTGGTGATGGTGG + Intronic
1036807709 8:11846919-11846941 CTGGGGAAGAGGGCTGTGTGGGG - Intronic
1037634950 8:20693248-20693270 CTGGGGAGGGGAGCAGTGGGAGG + Intergenic
1037726049 8:21483298-21483320 TTGGGGAAGGGAGGTGTGGATGG - Intergenic
1037802632 8:22043767-22043789 TTGGGGGTGGGAGGTGTGCATGG - Intronic
1037838925 8:22230532-22230554 CTGGGGAAGGGCAGGGTGTGAGG + Intronic
1037949631 8:23010515-23010537 CTGGGGAGGGAAGGAGTGAGCGG - Intronic
1038054168 8:23842668-23842690 CTGGGGGTGGGAAGTGTGGGAGG + Exonic
1038487612 8:27948175-27948197 CTGAGGAGGGGAGCTGGGTGGGG + Intronic
1038733265 8:30146454-30146476 CTGGGGATGAGATTTGGGTGGGG + Intronic
1038895241 8:31775442-31775464 CAGAGGATGGGAGGGGTTTGAGG + Intronic
1040038866 8:42896853-42896875 CTGGGGAGGAGCGGTGTGGGCGG + Intronic
1040530192 8:48260627-48260649 CTGGGGAAGGAAGGTGGGTGCGG - Intergenic
1041544664 8:59029219-59029241 ATGGGGATGGGGGGTGGGTGGGG - Intronic
1042333163 8:67604061-67604083 CTGGTGATGGAGGTTGTGTGGGG + Intronic
1043064788 8:75555046-75555068 CAGGTGATGGGAGGCGTGAGAGG - Intronic
1043941943 8:86205644-86205666 GTGGGGAGGGGAGGGGAGTGGGG + Intergenic
1044511446 8:93085009-93085031 CAGGAGGTGGGCGGTGTGTGAGG - Intergenic
1044985564 8:97753646-97753668 CTGGGGATGGAAAGTGTGCAAGG + Intergenic
1045178156 8:99749364-99749386 CAGGGGAAGGGAGGTGGGTATGG - Intronic
1045181842 8:99792592-99792614 CTGGGGCAGGGAGCTGTGGGAGG + Intronic
1046027947 8:108747700-108747722 CAGGGGGTGGGAGGTGGGAGAGG - Intronic
1046598250 8:116286735-116286757 CTGGTGAAGGGAGGTGGCTGAGG - Intergenic
1046754863 8:117962750-117962772 TTGGGGGTGGGGGGTGTGGGGGG - Intronic
1046769120 8:118100882-118100904 CTGGGGCTTGCATGTGTGTGGGG - Intronic
1047262106 8:123273341-123273363 CTGGGAAGGAGAGGTGTGAGAGG - Intronic
1047309275 8:123677908-123677930 CTGGGCAGGGCAGGGGTGTGTGG + Intergenic
1047537078 8:125729713-125729735 ATGAGGATGGCAGGTGTCTGAGG + Intergenic
1047998344 8:130357790-130357812 CTGGGGACTGGAGGTGGGAGAGG - Intronic
1048737062 8:137513597-137513619 ATGGGGATGGGAGTTGTCTCTGG + Intergenic
1048928275 8:139290334-139290356 CTGGGGCTGGGAGATGAGTAGGG + Intergenic
1049438496 8:142598620-142598642 CTGGGGGTGGGAGGGCTCTGAGG - Intergenic
1049443089 8:142618062-142618084 GTGGGGTGGGCAGGTGTGTGTGG - Intergenic
1049664420 8:143836682-143836704 TGGGGGATGGGAGGGGTGGGGGG + Intronic
1049780583 8:144426899-144426921 CCGGGCATAGGAGGTGAGTGTGG - Exonic
1049793700 8:144485830-144485852 CTGGGAAAGGGAGGTGGCTGTGG - Intronic
1050010124 9:1177441-1177463 CTGGGGAAGGGAGGAGGGTGTGG + Intergenic
1050851172 9:10288154-10288176 TTGGGGGTGGGGGGTGGGTGAGG + Intronic
1051524044 9:18022444-18022466 CTGGCTATGGGAAGTGGGTGAGG + Intergenic
1051825326 9:21212331-21212353 CTGGTGATGTGAGGGGTGGGTGG - Intronic
1053203349 9:36167106-36167128 CTGGGGGTGGGGGGTGAGGGGGG + Intergenic
1053539515 9:38959076-38959098 GTGGGGGTGGGAGGTGGTTGGGG - Intergenic
1054451048 9:65403848-65403870 TTGGGGGGTGGAGGTGTGTGGGG - Intergenic
1054626626 9:67404842-67404864 GTGGGGGTGGGAGGTGGTTGGGG + Intergenic
1056410083 9:86317091-86317113 CTGGGGAAGGGAGGGTTGAGGGG + Intronic
1056578406 9:87872806-87872828 CTGGGGCTGGGAGGAAGGTGGGG - Intergenic
1056707270 9:88961791-88961813 CTGGGAAAGTGAGGTCTGTGGGG - Intergenic
1056910291 9:90693988-90694010 GTGTGTATGGGTGGTGTGTGGGG + Intergenic
1057274366 9:93668502-93668524 CTGGGGGTTGGGGGTGTCTGAGG + Intronic
1057547976 9:96032189-96032211 CTGATGAAGGGAGGTGTGTGGGG - Intergenic
1058050561 9:100402044-100402066 GTGGGGATGGGAGGTGGGGAAGG - Intergenic
1058154778 9:101502892-101502914 ATGGGGAATGGAGGTGAGTGAGG + Intronic
1058668667 9:107342483-107342505 CTGGGCAGGGGAGGTGTCTGGGG + Intergenic
1058779362 9:108317877-108317899 CTGGGGATCAGCAGTGTGTGTGG + Intergenic
1059505881 9:114799595-114799617 CTGGGGATGTGAAGTGGGTGGGG - Intronic
1059634192 9:116155462-116155484 CTGGGGAGCGGAGGTGGGGGCGG + Intronic
1060584864 9:124779654-124779676 TTGGGGGTGGGAGGTGTCTGGGG - Intronic
1060828981 9:126702111-126702133 CTTGGGATGGGATGTGGCTGTGG + Intergenic
1060874596 9:127073239-127073261 CAGAGGCTGGGAAGTGTGTGTGG - Intronic
1060877259 9:127092324-127092346 CTGGAGATGAGCTGTGTGTGAGG + Intronic
1060943782 9:127558087-127558109 GTGGGGGTGGGAGGGGAGTGTGG + Intronic
1060970459 9:127734817-127734839 TTGGGGATGGGCGGGGTCTGCGG - Intronic
1060997831 9:127885125-127885147 CTGGGGATGGTGGGGGCGTGCGG - Intergenic
1061082954 9:128383179-128383201 CAGGGACTGGGAGGGGTGTGGGG - Intronic
1061715542 9:132516466-132516488 GTGTGGAAGGGAGGTGGGTGTGG + Intronic
1062218834 9:135403588-135403610 CGAGGGTTGGGAGGTGAGTGTGG - Intergenic
1062300832 9:135867895-135867917 CTGAGGATGGGAGGCGTCTTGGG - Intronic
1062311604 9:135940925-135940947 GTGGTGCTGGGAGCTGTGTGGGG - Intronic
1062546688 9:137066721-137066743 CTGGGTAAGGGAGGAGTGGGCGG + Intronic
1062682157 9:137787853-137787875 TTGGGGATAGGAGGTGGGTGGGG + Intronic
1062716667 9:138013983-138014005 TGGGGAATGGGAGGTGTGGGGGG - Intronic
1203656466 Un_KI270753v1:2664-2686 CTGGGGATGGTGGGGGAGTGAGG - Intergenic
1186168177 X:6849090-6849112 CTGGAGCTGGGAAGTATGTGGGG + Intergenic
1186356820 X:8799639-8799661 CAGGGGAGGGGAGGGGTGTGGGG - Intronic
1186357147 X:8800754-8800776 CAGGGGAGGGGAGGGGTGTGGGG - Intronic
1186410561 X:9342184-9342206 AGGGGGATGGGAGGTGAGGGAGG - Intergenic
1187293387 X:17976505-17976527 CTGGAGATGGGAGGGGTGCCAGG - Intergenic
1187660002 X:21534088-21534110 CTGAGAATGGGAGGGGTGAGTGG - Intronic
1189195014 X:39145600-39145622 CTGGGTATGAGATGTCTGTGGGG + Intergenic
1189317112 X:40064109-40064131 TGGGGGAGGGGAGGTGTGGGCGG + Intronic
1189747800 X:44188102-44188124 CTGGGGACTGCAGGTATGTGAGG + Intronic
1189909170 X:45792710-45792732 ATGGGGGTGGGAGGGGTGAGGGG - Intergenic
1189989224 X:46578594-46578616 TTGGGGATGGGCGGGGAGTGGGG + Intronic
1190015583 X:46824204-46824226 TAGGGGACGGGAGGTTTGTGAGG - Intergenic
1190117850 X:47637720-47637742 CTGCGGAGGGGTGGGGTGTGTGG - Intronic
1190148134 X:47917374-47917396 CTTGGGATGGGAGGAATCTGTGG - Exonic
1190263570 X:48814744-48814766 CTGGGGATCTGGGGTGTGTTGGG + Intronic
1190267009 X:48832538-48832560 GTGGGGGTGGGGGGTGTCTGGGG - Intronic
1190369986 X:49731180-49731202 CTGTGAATGGGAGCTGGGTGAGG + Intergenic
1190542717 X:51495636-51495658 CTGCTTTTGGGAGGTGTGTGTGG - Intronic
1190890081 X:54560108-54560130 TGGGGGATGGGAGGTGTGCGTGG + Intronic
1191590123 X:62873624-62873646 CAGGGGTGGGTAGGTGTGTGTGG - Intergenic
1192180766 X:68914368-68914390 TTGGGGTTGGAATGTGTGTGGGG - Intergenic
1192203970 X:69084081-69084103 CTGGTGAGTGGAGGTGGGTGAGG - Intergenic
1192288857 X:69769871-69769893 ATGGGCAGGGGTGGTGTGTGTGG + Intronic
1193178690 X:78427309-78427331 CTGGGGAGGGGAGGTGGAAGAGG + Intergenic
1193347794 X:80424108-80424130 CTGGAGATGGGTGTTGTGTGGGG + Intronic
1193355272 X:80512901-80512923 CTGGAGAGGGGTGTTGTGTGGGG + Intergenic
1193646183 X:84071164-84071186 CAGGGTATGAGAGGGGTGTGAGG + Intronic
1194841619 X:98751432-98751454 CTGGAGATGAGATTTGTGTGGGG + Intergenic
1195732858 X:107982838-107982860 GGGGTGATGGGAGGAGTGTGGGG - Intergenic
1196704538 X:118705676-118705698 GTGGGGAAGGGAGGAGAGTGAGG - Intergenic
1196871414 X:120116238-120116260 GTGGAGATGGGAGGTGTGGGTGG + Intergenic
1197784512 X:130186982-130187004 CTGGGGCTGGGAGTTGGATGGGG - Intergenic
1198376049 X:136041291-136041313 CACGGGGAGGGAGGTGTGTGTGG - Intronic
1198392477 X:136190129-136190151 GTGGGGATGTGAGGTGAATGGGG + Intronic
1198437635 X:136632403-136632425 TTTGGGATGGGAGATGTTTGAGG + Intergenic
1199601349 X:149543248-149543270 CAGGGGATGGAAGGCCTGTGTGG + Intronic
1199649028 X:149936236-149936258 CAGGGGATGGAAGGCCTGTGTGG - Intronic
1199721701 X:150547262-150547284 CTGGGCATGGGGTGAGTGTGGGG + Intergenic
1199892021 X:152094440-152094462 CTGGGGGTGGGTGGGGTGGGTGG + Intergenic
1200837844 Y:7750212-7750234 GTGGTGACGGTAGGTGTGTGGGG + Intergenic
1202598331 Y:26567017-26567039 GTGGGGTTGGGGGGTGTGAGTGG - Intergenic