ID: 1067759862

View in Genome Browser
Species Human (GRCh38)
Location 10:49036758-49036780
Sequence CACCCAGCAGATGTGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067759858_1067759862 1 Left 1067759858 10:49036734-49036756 CCGGGGGAAGAAACTTCTTCCCA 0: 1
1: 0
2: 1
3: 26
4: 239
Right 1067759862 10:49036758-49036780 CACCCAGCAGATGTGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067759862 Original CRISPR CACCCAGCAGATGTGGAACA AGG Intronic
No off target data available for this crispr