ID: 1067760569

View in Genome Browser
Species Human (GRCh38)
Location 10:49042503-49042525
Sequence CTTTGCCTCAGTGCGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067760569_1067760573 11 Left 1067760569 10:49042503-49042525 CCAGACTCCGCACTGAGGCAAAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1067760573 10:49042537-49042559 CTGGTGAAAACCTTAGATTTTGG No data
1067760569_1067760571 -8 Left 1067760569 10:49042503-49042525 CCAGACTCCGCACTGAGGCAAAG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1067760571 10:49042518-49042540 AGGCAAAGCTTCCAATGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067760569 Original CRISPR CTTTGCCTCAGTGCGGAGTC TGG (reversed) Intronic
902995866 1:20224174-20224196 CTTTCCCTCAGTCCGTGGTCTGG + Intergenic
903766182 1:25736143-25736165 CTTTGCCTCAATGGGGAGAAGGG - Intronic
905105705 1:35562424-35562446 GTTTGCCTCGGTGCGGATCCTGG + Exonic
908122280 1:60997561-60997583 CCTTGGAGCAGTGCGGAGTCTGG - Intronic
908169763 1:61493027-61493049 GATTGCCTCAGTGAGGAGTTAGG - Intergenic
908767257 1:67565358-67565380 CTCTGCCTCACTGAAGAGTCTGG - Intergenic
914975917 1:152361834-152361856 TTCTGTCTCAGTGTGGAGTCTGG - Intergenic
918477697 1:184942765-184942787 CATTGCCTCAGAGCTGAGTGTGG - Intronic
922223558 1:223626869-223626891 CTTTGGGTCAGAGCAGAGTCTGG - Intronic
923397782 1:233584130-233584152 CGTTGCTTCAGAGAGGAGTCTGG + Intergenic
924143423 1:241049511-241049533 CTTTGCTACAGTGGGTAGTCAGG + Intronic
1066083964 10:31959288-31959310 TTTTGCCTCAGTGAGGTGTGGGG + Intergenic
1067760569 10:49042503-49042525 CTTTGCCTCAGTGCGGAGTCTGG - Intronic
1068591506 10:58857343-58857365 CCTGGCCTCAGTGCTGAGGCAGG - Intergenic
1070153434 10:73819236-73819258 CCTTGCCTCAGCGCTGAGCCAGG - Intronic
1070906627 10:80078932-80078954 CTTGCTCTCATTGCGGAGTCTGG - Intronic
1073121359 10:101124280-101124302 CTGTGCTTCAGTGTGTAGTCAGG + Intronic
1074198016 10:111206389-111206411 CTTTGCCTCCTTGGTGAGTCTGG - Intergenic
1075412907 10:122242147-122242169 CTTTGCCCCAGGACAGAGTCTGG + Intronic
1076188679 10:128467984-128468006 CTTTGCCTCAGGGAGGAGCAGGG + Intergenic
1078687454 11:13546635-13546657 CAGTGCCTCAGTGGGGACTCTGG - Intergenic
1079131617 11:17750067-17750089 CTCTGCCTCAGTGTGGACTCGGG + Intronic
1080728488 11:34921338-34921360 CCTTGCCTCAGTGGTGATTCAGG + Intronic
1090079638 11:123603358-123603380 CAGTGCCTCTGTGCAGAGTCGGG + Intronic
1093741447 12:22693534-22693556 CTTGGCCTCAGTGCCCACTCTGG - Intergenic
1098508440 12:71282615-71282637 CTTACCCTCAGTGCGGGGTGTGG + Intronic
1100927564 12:99567013-99567035 CTTTTCATCAGTCAGGAGTCTGG + Intronic
1102405057 12:112666115-112666137 CTTTACCTGAGTTGGGAGTCAGG + Intronic
1102416462 12:112767084-112767106 CTTTGCATGAGTGAGGAGCCTGG - Intronic
1105887546 13:24654766-24654788 GGGTGCCTCAGTGTGGAGTCTGG - Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1110159929 13:72363677-72363699 CTTTGCCCATGTGCAGAGTCCGG - Intergenic
1111816120 13:93155030-93155052 CTTTGCCTGAGTGCAGAGAAAGG - Intergenic
1114636457 14:24189759-24189781 CTTTGCCACAGTATGGGGTCGGG - Exonic
1119323790 14:73746695-73746717 CTTTGGCCCAGGGCAGAGTCTGG - Intronic
1120633444 14:86920920-86920942 CTTTGTCTCAGTGATTAGTCTGG + Intronic
1124061656 15:26298549-26298571 CTTGGCCTCAGTGCCCACTCTGG - Intergenic
1124927530 15:34085914-34085936 CTTTTCCTCACTGTGGAGCCTGG + Intronic
1127263277 15:57341317-57341339 CTTTGCCTCTGTATGGGGTCGGG + Intergenic
1131438623 15:92442177-92442199 CTGTGCCTCAGTGAGGATGCTGG - Intronic
1132903569 16:2271144-2271166 CATGGCCTCAGTGCAGAGCCAGG - Intergenic
1138492015 16:57382458-57382480 CTTTGCCTCAGCCCAGAGGCTGG - Exonic
1140514543 16:75532538-75532560 CTTCGCCTCAATGCGGGGACAGG + Intronic
1140671876 16:77287456-77287478 CTGTGCCTCATGGCTGAGTCAGG - Intronic
1143787734 17:9268723-9268745 CTGTGTCTCAGAGCTGAGTCGGG - Intronic
1143862240 17:9899368-9899390 CAATGCCTCAGGGCAGAGTCAGG - Intronic
1144055839 17:11539827-11539849 CTTTGGCACAGTGCCCAGTCAGG - Intronic
1146824077 17:36008453-36008475 CTTCGTCTCAGTGGAGAGTCAGG - Intergenic
1147136635 17:38437868-38437890 CTGTGATTCAGTGTGGAGTCTGG + Intronic
1147597934 17:41728544-41728566 CTTTACCTCAGTGTGGCGGCTGG - Intronic
1147627771 17:41910871-41910893 CTGTGCGTCACTGCTGAGTCAGG + Intronic
1151840720 17:76615396-76615418 CTTGGCCTCAGTGCCCACTCTGG - Intergenic
1152181229 17:78822960-78822982 CTTTGTGCCAGTGAGGAGTCGGG - Intronic
1154981901 18:21509319-21509341 CGGTGCCTCAGTGCCAAGTCAGG + Intronic
1157541092 18:48507879-48507901 TTTTGACTCAGTGCTCAGTCAGG - Intergenic
1157972214 18:52283714-52283736 CTTAGCCTCAGTTCGCAGTGGGG + Intergenic
1161993586 19:7698957-7698979 CTTTGCTTCAGTGTGGGCTCTGG - Intronic
1164193923 19:22936608-22936630 CTGTGCCTCTGAGCTGAGTCTGG - Intergenic
1166624177 19:44334924-44334946 CAATGCCTCAGTGGGGACTCTGG - Intronic
926044158 2:9697487-9697509 CTTTGCCTCGGTGAAGAGACTGG - Intergenic
928254294 2:29708542-29708564 GATTGCCTCAGTGTGGGGTCAGG - Intronic
929999280 2:46850024-46850046 CTTTGACACAGTGCTGAGTCAGG + Intronic
932748638 2:74356522-74356544 CTCTGCCTCAGTGGGGAGCAGGG - Intronic
932984747 2:76711699-76711721 CAATGGCTCAGTGGGGAGTCTGG + Intergenic
933495532 2:83046127-83046149 CTTTGCAGCAGGGAGGAGTCTGG - Intergenic
937315821 2:120931551-120931573 CTGAGCCCCAGTGTGGAGTCTGG + Intronic
937845398 2:126573575-126573597 CTTTGCCCCAGTGCAGTGTCTGG + Intergenic
938480337 2:131657619-131657641 CATTGCCTTACTGCGGACTCAGG - Intergenic
941860213 2:170271555-170271577 CTTTGCCTAAGTGTGGAATCTGG + Intronic
942711770 2:178844535-178844557 CTTTGCCTCAGAGAGGAATCTGG + Intronic
946165471 2:217860974-217860996 TTTTGCCTCTGTGTGGAGCCAGG - Intronic
947562274 2:231166412-231166434 CTGTGCCTCATTTCTGAGTCAGG - Intronic
1179079342 21:38156163-38156185 CTTTCACTCAGTGTGCAGTCAGG + Intronic
1180008583 21:45034846-45034868 CTGTGGCTCAGGCCGGAGTCTGG - Intergenic
954371109 3:50169979-50170001 CTTTGCCTCATGGTGGAGTGGGG + Intronic
954656169 3:52195507-52195529 ATCTGCCTCAGTGATGAGTCTGG - Intergenic
956026695 3:64990069-64990091 CTTTGCCTCACTGCAGCGACTGG - Intergenic
958488211 3:94739221-94739243 CTTTGCCTCACAGGGAAGTCAGG - Intergenic
967084932 3:186085967-186085989 CATGGCTGCAGTGCGGAGTCTGG - Intronic
968927375 4:3556668-3556690 CTTAGCCTCAGGGAGGAGGCTGG - Intergenic
970169432 4:13275026-13275048 CCTTGCCTAAGTGAGAAGTCAGG - Intergenic
970260331 4:14217625-14217647 CTTTGCATCAGGGAGGAGCCTGG + Intergenic
977827585 4:101551969-101551991 CGTAGCTTCAGTGCAGAGTCTGG + Intronic
981580755 4:146246388-146246410 CTTAGCCCCAGTGCTAAGTCAGG - Intergenic
981665712 4:147223746-147223768 CATAGCCTCAGTGGGGAGTGCGG + Intergenic
982071914 4:151702995-151703017 CTTCCCCTGAGTGTGGAGTCCGG - Intronic
983760237 4:171396253-171396275 TTATCCCTCAGTGGGGAGTCAGG - Intergenic
995225733 5:109698720-109698742 ATTGGCTTCAGTGAGGAGTCCGG + Intronic
995495452 5:112737716-112737738 CTGTGCCCCACTGCGGAGTGCGG + Intronic
995858130 5:116615057-116615079 CTTTGCCTCAGTGCCCAGCCTGG - Intergenic
1024617639 7:51128916-51128938 ATTTCCCTCAGTGCGAGGTCGGG - Intronic
1030046903 7:105505433-105505455 CTTGGCCTCAGTTGGGACTCTGG - Intronic
1030722614 7:112886776-112886798 CTTTGCCTCTGTGTGGGGGCAGG - Intronic
1042824207 8:72963758-72963780 CTTTACCCCACTGCGGAGTTGGG - Intergenic
1045418837 8:101993968-101993990 CTTTTCATCAGTCCAGAGTCTGG - Intronic
1048054240 8:130848229-130848251 CTGTGCCTCAGTGAGTAGTGTGG - Intronic
1049436430 8:142588242-142588264 GTTTGCCTCAGGGCGGAGGCAGG + Intergenic
1049904585 9:203979-204001 TTTTGCCTCATTGCCCAGTCTGG + Intergenic
1051869025 9:21715231-21715253 CTGTGCCCTAGTGCGGACTCTGG + Intergenic
1053547172 9:39035538-39035560 CTCAGCCTCAGTTTGGAGTCTGG - Intergenic
1053811486 9:41857206-41857228 CTCAGCCTCAGTTTGGAGTCTGG - Intergenic
1054619108 9:67330233-67330255 CTCAGCCTCAGTTTGGAGTCTGG + Intergenic
1056752529 9:89362891-89362913 CTTTGTCTCCGTGGGGAGACAGG + Intronic
1060269079 9:122128462-122128484 CTTTGTCTCTGTGTGGAGTGGGG - Intergenic
1061826611 9:133261858-133261880 ATTTTCCTAAGTGTGGAGTCTGG - Intronic
1061985180 9:134126463-134126485 CTTTGCCTAAGTGAGGAGCCCGG + Intergenic
1186270020 X:7877039-7877061 TTTTGCTTCTGTGCTGAGTCTGG - Intergenic
1189006531 X:37000333-37000355 CTTTGCAGCAGTGAGGAGCCTGG + Intergenic
1195398097 X:104432736-104432758 GTTTGCCTCACTCTGGAGTCAGG - Intergenic
1196893107 X:120309276-120309298 CTTTCCCGCAGTGTGGAGACTGG + Intronic