ID: 1067762005

View in Genome Browser
Species Human (GRCh38)
Location 10:49055440-49055462
Sequence CATTATGTGCAGAATCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067761999_1067762005 -3 Left 1067761999 10:49055420-49055442 CCATAACCCCATGCCCAGAACAT 0: 1
1: 0
2: 1
3: 22
4: 199
Right 1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG No data
1067761995_1067762005 26 Left 1067761995 10:49055391-49055413 CCAAGATTTCACACAGCACACTC 0: 1
1: 0
2: 1
3: 13
4: 272
Right 1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG No data
1067762001_1067762005 -10 Left 1067762001 10:49055427-49055449 CCCATGCCCAGAACATTATGTGC 0: 1
1: 0
2: 0
3: 28
4: 180
Right 1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG No data
1067761998_1067762005 -2 Left 1067761998 10:49055419-49055441 CCCATAACCCCATGCCCAGAACA No data
Right 1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG No data
1067762000_1067762005 -9 Left 1067762000 10:49055426-49055448 CCCCATGCCCAGAACATTATGTG 0: 1
1: 0
2: 0
3: 20
4: 175
Right 1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG No data
1067761996_1067762005 2 Left 1067761996 10:49055415-49055437 CCACCCCATAACCCCATGCCCAG 0: 1
1: 0
2: 3
3: 32
4: 454
Right 1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG No data
1067761994_1067762005 30 Left 1067761994 10:49055387-49055409 CCTTCCAAGATTTCACACAGCAC 0: 1
1: 0
2: 1
3: 13
4: 164
Right 1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG No data
1067761997_1067762005 -1 Left 1067761997 10:49055418-49055440 CCCCATAACCCCATGCCCAGAAC 0: 1
1: 0
2: 2
3: 17
4: 199
Right 1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067762005 Original CRISPR CATTATGTGCAGAATCTTGA AGG Intronic
No off target data available for this crispr