ID: 1067763607

View in Genome Browser
Species Human (GRCh38)
Location 10:49069211-49069233
Sequence TGGAGGTCCCAACACTGTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067763607_1067763613 18 Left 1067763607 10:49069211-49069233 CCGTAACAGTGTTGGGACCTCCA 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1067763613 10:49069252-49069274 CCCACCTTACCCCTATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067763607 Original CRISPR TGGAGGTCCCAACACTGTTA CGG (reversed) Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906018498 1:42605190-42605212 TGGAGGTGCCAACACTGAAATGG - Intronic
1067763607 10:49069211-49069233 TGGAGGTCCCAACACTGTTACGG - Intronic
1069053877 10:63823617-63823639 TAGTTATCCCAACACTGTTATGG - Intergenic
1070060251 10:72975595-72975617 TGGAGTTCCAAACACTTTTTAGG + Intergenic
1072285026 10:93905918-93905940 TGGAGCTCCCAACCCTGGCATGG - Intronic
1077133540 11:987102-987124 GGGAGGTCACACCACTGTTGAGG + Intronic
1077251115 11:1561150-1561172 TGTAGGTCCCAGCACTCTTTGGG + Intronic
1083030412 11:59586446-59586468 TGGAAGACTCAACATTGTTAAGG + Intronic
1085432759 11:76468854-76468876 TGCAAGTCCCAGCACTCTTAAGG + Intronic
1086873033 11:92062424-92062446 TGGAAGCCCAAACACTGTTGAGG - Intergenic
1088780013 11:113124956-113124978 TGGAGGTACCACCAGTGTGATGG - Intronic
1089001728 11:115057707-115057729 TGGAGATCGCATCACTGTGATGG - Intergenic
1091235158 11:134017042-134017064 GGGAGATGCCAACCCTGTTACGG + Intergenic
1091415393 12:278487-278509 TGGAGGTCCAGAAATTGTTAAGG + Intergenic
1093150725 12:15618098-15618120 TGTTGGTCCCAAAAATGTTAGGG - Intergenic
1094289707 12:28833344-28833366 TGTAGGTCACAACACTCTGATGG - Intergenic
1094461901 12:30704973-30704995 TGGAGACCCCAACTCTGGTATGG - Intergenic
1097805170 12:63957422-63957444 TGGATGTCCCATCATAGTTATGG - Intronic
1100363734 12:93900409-93900431 TCGAGGTCCCACCATTGTTTGGG + Intergenic
1101670149 12:106863073-106863095 TGGAGGTCCCTTGACTGTAAAGG + Intronic
1101712959 12:107285808-107285830 AGGAGGTCTCAATGCTGTTATGG + Intergenic
1107904261 13:45047660-45047682 GGGAGGCCACAACACTGTTATGG + Intergenic
1110887012 13:80652575-80652597 TGGATGGCCAAACACTGGTAAGG + Intergenic
1112131408 13:96527850-96527872 TGGAGATCCCAAGACTGTCAGGG + Intronic
1116310465 14:43318977-43318999 TGTAGGTTCCAACACTTTTAGGG - Intergenic
1119096072 14:71832446-71832468 TGAATGTCCTAAAACTGTTAAGG - Intergenic
1123995076 15:25712799-25712821 TGGAGGTCACAGCTCTGTGATGG + Intronic
1132471633 16:107047-107069 TCCAGGACCCAAGACTGTTAGGG + Intronic
1133871129 16:9687378-9687400 TTGAGGTCCCAACAGTATTTGGG + Intergenic
1137888373 16:52131179-52131201 AGGAGGTCCCAACACTGGTGGGG + Intergenic
1138173106 16:54871469-54871491 GTGACGTCTCAACACTGTTATGG + Intergenic
1139406402 16:66722123-66722145 TAAAGGTCTGAACACTGTTAAGG - Exonic
1140514997 16:75535286-75535308 TTAAGGTCCCAAGACTATTAAGG + Intronic
1146730692 17:35191738-35191760 TGGAAGTCCCTACAGTTTTAAGG + Intergenic
1149740769 17:59043737-59043759 TGGAGGTCCCAAGCCTGAAAAGG + Intronic
1153507051 18:5811386-5811408 TGGAGCTCCTCATACTGTTATGG + Intergenic
1159852493 18:73541623-73541645 TGGAAGACTCAATACTGTTAAGG - Intergenic
1160412542 18:78685023-78685045 TGGAGGTGCCAGCTCTGATAGGG - Intergenic
1160534386 18:79584476-79584498 TGGAGTTCACAACACTTTTCTGG + Intergenic
1162328405 19:10012011-10012033 TGGGGGTCCCAGCACGGTGAGGG - Intergenic
1162713035 19:12610424-12610446 TGGACGCCTCAACGCTGTTATGG + Intronic
1163402139 19:17100674-17100696 TGGTGGTCCCAAGACTGCCAAGG - Intronic
933534602 2:83556623-83556645 TGTTGGCCCCAACTCTGTTATGG + Intergenic
935867513 2:107406494-107406516 TCAAGGTCCCTATACTGTTAAGG - Intergenic
944835773 2:203578158-203578180 GGAATGTTCCAACACTGTTAGGG + Intergenic
946664622 2:222035773-222035795 TGGAGCTGCCAGAACTGTTATGG - Intergenic
947739898 2:232480269-232480291 TGCAGGGCCCAACACTGTGTGGG - Intronic
1173152251 20:40577527-40577549 TGGAGGACCTAACACCATTATGG + Intergenic
1174024179 20:47558975-47558997 TGAAGATGCCATCACTGTTACGG - Intronic
1177730031 21:25016910-25016932 TGGAAGTCCCATCAGTGTTTGGG - Intergenic
1178048985 21:28728061-28728083 TGGAGGTCCCAAGTCTGAAATGG - Intergenic
1180746622 22:18093638-18093660 TGCAGGTTTCAGCACTGTTAAGG + Exonic
954671586 3:52294009-52294031 TGGGGGTCCCAGCACTGGGATGG + Intergenic
960715154 3:120567965-120567987 TGCTGGTCACAACACTATTAGGG - Intergenic
969296420 4:6272831-6272853 AGGTGGGCCTAACACTGTTAAGG - Intronic
971062265 4:22985615-22985637 TGGAAGACCCAACTCTGATAAGG - Intergenic
972180163 4:36455031-36455053 TGTATGTCCTAACACTGTTAAGG - Intergenic
978404628 4:108366015-108366037 TGGAGTTCCCAATAGTGTTTGGG - Intergenic
979799375 4:124889338-124889360 TTGAGTTCCCTACATTGTTATGG + Intergenic
983190380 4:164747806-164747828 TGGAGGTCCAAACAGTGTTTGGG + Intergenic
983627324 4:169814995-169815017 TGGAAGTCCCCAGACTGTTGTGG - Intergenic
984693061 4:182750986-182751008 TGGTAAGCCCAACACTGTTAAGG - Intronic
985795947 5:1962177-1962199 TGGTGGTCGCCACAGTGTTACGG + Intergenic
993327797 5:86563993-86564015 TGTGGGTCCAAACACTGTAAAGG + Intergenic
994660831 5:102652027-102652049 TGGAGGTTCAAGAACTGTTAAGG - Intergenic
1008279908 6:49584587-49584609 TGGAGGTCACAAACCTGTTTGGG + Intergenic
1009268205 6:61583812-61583834 TGGAAGACTCAATACTGTTAAGG - Intergenic
1010275601 6:73965315-73965337 AGGAGGACCCAACAAGGTTAAGG + Intergenic
1014719535 6:124899040-124899062 TGGGGGTCCCAAGACTTTTCAGG + Intergenic
1015710010 6:136129381-136129403 TGGAGGTCCCAACCCCATGAGGG + Intronic
1016599147 6:145837134-145837156 TGTACCTCCCAACATTGTTAGGG + Intergenic
1025006859 7:55362364-55362386 TGGTGGTCCCCATACCGTTAAGG - Intergenic
1027687673 7:81297273-81297295 TGGCTTTCCCAAGACTGTTATGG + Intergenic
1034565920 7:151915675-151915697 CGCAGGTGCCAACACTGTTCAGG + Intergenic
1039609021 8:38904276-38904298 TGGAGGTCCCAGCCCTGCTGGGG + Intronic
1040883034 8:52229282-52229304 TGGAGGTCCAAAGTCTGATACGG + Intronic
1048885639 8:138907164-138907186 TGGAGAGCCCCACACTGTGATGG - Intronic
1050475419 9:6035348-6035370 TGCTGGTCACAACACTGTGATGG - Intergenic
1055362807 9:75512515-75512537 TGGAGGTCCCAAAGAAGTTAAGG - Intergenic
1058207015 9:102120755-102120777 TGGAGGTGCAAGCAGTGTTAGGG - Intergenic
1059269473 9:113062825-113062847 GGGAGGTGCCAACACAGTAAGGG + Intergenic
1059270604 9:113068272-113068294 GGGAGGTGCCAACACAGTAAGGG + Intergenic
1059271737 9:113073719-113073741 GGGAGGTGCCAACACAGTAAGGG + Intergenic
1059272871 9:113079166-113079188 GGGAGGTGCCAACACAGTAAGGG + Intergenic
1059274006 9:113084608-113084630 GGGAGGTGCCAACACAGTAAGGG + Intergenic
1059275140 9:113090052-113090074 GGGAGGTGCCAACACAGTAAGGG + Intergenic
1060987293 9:127827001-127827023 TGGATCTCCCTACACTGTGAGGG + Intronic
1195219031 X:102729092-102729114 GGGAGGTCCCCACACTTTTGTGG + Intronic
1199871753 X:151904594-151904616 TGGAGGTCTCCTCACTGTTTTGG + Intergenic