ID: 1067765538

View in Genome Browser
Species Human (GRCh38)
Location 10:49083069-49083091
Sequence GGGGTTCCTGGACTCTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067765538 Original CRISPR GGGGTTCCTGGACTCTGCTG AGG (reversed) Intronic
900136649 1:1120473-1120495 GGGGTCCCTGAGCTCCGCTGGGG + Intergenic
900401587 1:2474995-2475017 GGCGTTTCTGGGCTCTGCCGTGG - Intronic
900915884 1:5638255-5638277 TGGTTTCCTGCCCTCTGCTGTGG - Intergenic
901432322 1:9224545-9224567 GGGCTTCCTGCACAGTGCTGCGG - Intergenic
902415420 1:16236122-16236144 GAGGTGCCTGGAATCAGCTGTGG - Intronic
902712067 1:18247289-18247311 TGGGTGCCTGGACTGTGCTGGGG + Intronic
902865187 1:19273360-19273382 CGGGTCCCTGGACTTTGCTCTGG - Intergenic
903054408 1:20625571-20625593 GGGGAGCCTGAACTCTGCTAAGG - Intergenic
903312500 1:22470718-22470740 GGGGTTCCTAGACTCTTCTGTGG - Intronic
904041684 1:27589040-27589062 GAGGTTTCAGGGCTCTGCTGAGG + Intronic
904330258 1:29754002-29754024 GGGGCTCCTGACCTCTCCTGGGG + Intergenic
905180175 1:36160806-36160828 GAGGACCCTGGGCTCTGCTGGGG - Intronic
905284169 1:36868443-36868465 GTGGCTCCTGAGCTCTGCTGTGG + Intronic
910288482 1:85578775-85578797 AGGGTTCCTGGCTTCTGTTGTGG - Intergenic
910858094 1:91716343-91716365 GCTGTTCCTGGAAGCTGCTGGGG + Exonic
911389479 1:97220974-97220996 GGGGCTCCTGGGCTCTACTTGGG - Intronic
911601190 1:99849986-99850008 GGGGGACCTGGAGCCTGCTGCGG - Intergenic
912689532 1:111794075-111794097 GGGGCTCAGGGACTCTGCTTTGG + Intronic
915035759 1:152922778-152922800 GGGGTTCTTGTTCTCTTCTGTGG + Intergenic
916073428 1:161185777-161185799 AGGGTTCCTGGAGTGTGCTGTGG - Exonic
916836650 1:168552965-168552987 GGGGGACCTGAAGTCTGCTGGGG - Intergenic
917738747 1:177943688-177943710 GGGGGCCCTGGATTCGGCTGTGG + Intronic
918532273 1:185537126-185537148 ATGGTTCCTTGGCTCTGCTGGGG + Intergenic
919817854 1:201452931-201452953 GGGCATCCTGGACTGTTCTGAGG - Intergenic
920080397 1:203368790-203368812 GGGATGCATGGACTGTGCTGTGG + Intergenic
922388010 1:225107625-225107647 GGGGTTCCTGTCCTGTGCTTTGG - Intronic
922756116 1:228097776-228097798 GGGGTTACTGGAGGCTGGTGGGG + Intronic
922879735 1:228971571-228971593 GGGGATGCTGGTCTCTGATGGGG + Intergenic
1063118049 10:3085414-3085436 GGGGTTGGGGGACTGTGCTGGGG - Intronic
1063118059 10:3085438-3085460 GGGGTTGGGGGACTGTGCTGGGG - Intronic
1063118069 10:3085462-3085484 GGGGTTGGGGGACTGTGCTGGGG - Intronic
1064634158 10:17346624-17346646 GGGCTGCCTGGGCTCAGCTGGGG - Intronic
1065186063 10:23172412-23172434 GCGGCTCCTGGCCTCTGCGGGGG + Intergenic
1066950794 10:42113429-42113451 GGCATTCCTGGACTGTGATGTGG + Intergenic
1067765538 10:49083069-49083091 GGGGTTCCTGGACTCTGCTGAGG - Intronic
1073081444 10:100863460-100863482 GAGGCTCCTGGGCTGTGCTGGGG - Intergenic
1073300061 10:102465733-102465755 GGGGCTGCTGTTCTCTGCTGGGG + Intronic
1073570059 10:104573609-104573631 GGAAGACCTGGACTCTGCTGTGG - Intergenic
1074474293 10:113755290-113755312 CGGGTACCTGGACTCTTCTGAGG - Intronic
1075953822 10:126505389-126505411 GGGGTTCCTGGGCTTGGCGGAGG - Intronic
1076423270 10:130349033-130349055 GGGCATCCTCGAGTCTGCTGCGG - Intergenic
1076731411 10:132440844-132440866 GGGGCTCAGGGACGCTGCTGAGG - Intergenic
1077011297 11:380495-380517 CGGGTTCCTGGACTTTACCGCGG - Intronic
1078094772 11:8290023-8290045 AGGGGCCCTGGGCTCTGCTGTGG - Intergenic
1079187358 11:18249277-18249299 GGGGCTCCAGGACTAGGCTGGGG - Intergenic
1081846434 11:46243735-46243757 GTGGATCCTGGACAGTGCTGCGG - Intergenic
1083473469 11:62900223-62900245 AGGGTTCCTGACCTCTGCTCAGG - Intergenic
1084031742 11:66485172-66485194 GGCGTTCCTGGTCTATGCCGCGG + Exonic
1084587441 11:70070865-70070887 GGGGTTCCAGGACTCCGCCTTGG - Intergenic
1084953514 11:72679417-72679439 GAGGGCCCTGGACTCAGCTGGGG - Intergenic
1085171957 11:74457178-74457200 GGGCCTCCAGAACTCTGCTGTGG - Exonic
1088349647 11:108871354-108871376 GGGCATCCTGCCCTCTGCTGGGG + Intronic
1088595457 11:111437377-111437399 GGAGTCCCTGGACTCATCTGGGG - Intronic
1088830497 11:113532340-113532362 GGGGTTCCTGGGGGCTTCTGAGG + Intergenic
1089347181 11:117797735-117797757 GGGGTGGCTGGACTCATCTGGGG - Intronic
1090186357 11:124741587-124741609 GAGGTTCCTGGGCTCCACTGAGG + Intronic
1094487933 12:30939657-30939679 GGCTTTCCCGGGCTCTGCTGTGG + Intronic
1096693060 12:53332962-53332984 GGGGTCCCTGGGCTTGGCTGAGG - Intronic
1097232226 12:57519926-57519948 GGGGCTACTGGACCCTGCAGCGG - Intronic
1097397486 12:59093601-59093623 GGTGTTCCTGGACTCCACTCTGG - Intergenic
1097746685 12:63311001-63311023 AGGGTTCCTGGACTCAGAAGTGG + Intergenic
1104950698 12:132438654-132438676 TGGGTTCCTGCCCTCCGCTGGGG - Intergenic
1105585398 13:21738566-21738588 GGGGTCCCTGTGCTTTGCTGCGG - Intergenic
1106079153 13:26486123-26486145 GGGGTTCCTGGAGTCTCCTCAGG - Intergenic
1108456217 13:50616614-50616636 GGGGCTCATTGACTCTTCTGAGG + Intronic
1110362277 13:74641220-74641242 GGTGTTCCTGGAATCTGCCAGGG + Intergenic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1113531874 13:111033058-111033080 GTCCTTCCTGGCCTCTGCTGGGG - Intergenic
1115010564 14:28540185-28540207 GGGGTCCCTGGACTCAGCCCAGG - Intergenic
1115748047 14:36458854-36458876 TGGGTTCCTGGACTCGGTTTTGG - Intergenic
1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG + Intronic
1121343030 14:93116163-93116185 GGGGGTGCTGAACCCTGCTGGGG - Intronic
1122107725 14:99471071-99471093 GAGGTTCAGGGACTGTGCTGTGG - Intronic
1122317424 14:100834465-100834487 TGGGTTTCTGGACTTTTCTGAGG + Intergenic
1122348587 14:101075128-101075150 AGGGTCCCTGGCCTCTGCTCAGG - Intergenic
1122691376 14:103533497-103533519 CTGGGTCCTGGTCTCTGCTGAGG + Intronic
1123133456 14:106006897-106006919 GGGGAGCCTGGACTCTTCTTAGG - Intergenic
1123583480 15:21737344-21737366 GGGGAGCCTGGACTCTTCTTAGG - Intergenic
1123620130 15:22179947-22179969 GGGGAGCCTGGACTCTTCTTAGG - Intergenic
1125729256 15:41883544-41883566 AGGGTTCCTGGTCTGTGGTGGGG + Intronic
1128128658 15:65211203-65211225 GGGGTTCCTGTCCTCAGGTGGGG + Intronic
1128306838 15:66604327-66604349 GGGGGTCCTGGGCCCTGCTCAGG - Intronic
1128532394 15:68463423-68463445 GGGAATCCTGGTCTCTGCTGGGG - Intergenic
1129232488 15:74204458-74204480 GGGCTTGCTGGCCTCTGGTGTGG - Intronic
1130351065 15:83092170-83092192 GGAGTTCCTAGATTATGCTGTGG + Intergenic
1130841399 15:87704380-87704402 GAGGTTCCTGAACACTGCAGAGG + Intergenic
1131249056 15:90819089-90819111 GGGCTTTCTGGACTCTACTTCGG - Intergenic
1131754224 15:95542820-95542842 GGGTTTCCTGGGGTCTTCTGTGG + Intergenic
1132617989 16:851822-851844 GGGGCCCCTGGACCCAGCTGGGG - Intergenic
1132866956 16:2097831-2097853 GGGGGTCCTGGGCTGGGCTGGGG - Intronic
1132974964 16:2706596-2706618 GGGGTTCCTGGACACTGGTGAGG + Intronic
1134548089 16:15125654-15125676 GGGGGTCCTGGGCTGGGCTGGGG - Intronic
1134720264 16:16377071-16377093 GGGGGTCCTGGGCTGGGCTGGGG + Intergenic
1134947163 16:18334814-18334836 GGGGGTCCTGGGCTGGGCTGGGG - Exonic
1135052688 16:19205256-19205278 TGGCCTCCTGGACTCTGCTTCGG + Intronic
1136938965 16:34501505-34501527 GGCATTCCTGGACTGTGATGTGG + Intergenic
1136960855 16:34847051-34847073 GGCATTCCTGGACTGTGATGTGG - Intergenic
1137219170 16:46429023-46429045 GGCATTCCTGGACTGTGATGTGG + Intergenic
1137528634 16:49261580-49261602 GGTGCTCCAGGACTCTGCTCAGG + Intergenic
1137711939 16:50572623-50572645 GGGGTTCAGGGGATCTGCTGTGG + Intronic
1137786252 16:51140169-51140191 GGGACTCCTGGACTCAGCTCAGG - Exonic
1141937872 16:87254057-87254079 GGGGTTCCTTGTCCTTGCTGTGG - Intronic
1142047763 16:87936633-87936655 GGGATTAGTGGCCTCTGCTGGGG + Intergenic
1142267649 16:89071855-89071877 GGGTGTCCTGGGCTCTGCTGCGG + Intergenic
1142900424 17:3008124-3008146 GGGGTTCCTGGAGTCTTTTAAGG + Exonic
1143309838 17:5979052-5979074 AGGGGTCCTGGACACTCCTGCGG + Intronic
1143409963 17:6702870-6702892 GGCTTTCCAGGACTCTGCAGAGG + Intronic
1143482347 17:7234841-7234863 GGGGTTCCTAGACTCGAGTGGGG + Intergenic
1143566237 17:7722565-7722587 GCGGTTCCTGGGATCTGCGGGGG - Intronic
1144762760 17:17716776-17716798 GGTGCTGCTGGACTCTGTTGTGG + Intronic
1145959857 17:28881038-28881060 AGGGTTCCTGCCCCCTGCTGAGG + Intronic
1147452054 17:40511892-40511914 GCTTTTCCTAGACTCTGCTGAGG - Intergenic
1148625701 17:49067441-49067463 GAGATGCCAGGACTCTGCTGTGG - Intergenic
1149143131 17:53458019-53458041 GGGGTCCCTGGACACTGCCCAGG - Intergenic
1153180819 18:2430648-2430670 AGAGTTCCTGGACTATACTGTGG + Intergenic
1157587610 18:48814821-48814843 GGGGTCCCTGGAGTCTCTTGTGG + Intronic
1159563163 18:70017216-70017238 GGGCTTCCAGGAGTCTCCTGAGG - Intronic
1160092298 18:75838822-75838844 TGGGTTCCTGGACTCTCTTGTGG + Intergenic
1160336169 18:78042335-78042357 TGGGATCCTGGACTCTGCCTGGG - Intergenic
1160434803 18:78841551-78841573 GGGTGTCCTGCTCTCTGCTGGGG + Intergenic
1162015699 19:7845414-7845436 AGGGCTCCTGGGTTCTGCTGTGG - Intronic
1162836722 19:13324214-13324236 GTGGTTCCTGGAGGCTGCAGGGG + Intronic
1163248598 19:16112185-16112207 GGGGTTCCTGGGCCGTGGTGGGG + Intronic
1163644626 19:18481633-18481655 CAGGTTCCTGGAATCTGCTGTGG + Intronic
1166308130 19:41946806-41946828 GGGTTTCCTGTACTCAGGTGTGG - Intergenic
1166749802 19:45159387-45159409 AGGGATCCAGGAATCTGCTGTGG - Intronic
1166932910 19:46312313-46312335 GGGGGTCCTGGTGTCAGCTGGGG - Intronic
1167032908 19:46975338-46975360 GGGCTTCCTGCACCCTTCTGAGG + Intronic
1167299466 19:48670669-48670691 GGGGTCCCTGGAGGCTGCTGTGG - Exonic
1167399339 19:49254627-49254649 GAGGTTGCAGGACTCAGCTGGGG + Intergenic
1167439336 19:49499450-49499472 GGGCCTCCTGGGGTCTGCTGGGG + Intronic
1167482260 19:49740210-49740232 GGGCTTGCTGGACTGGGCTGGGG + Intronic
925405850 2:3605253-3605275 CGGCGGCCTGGACTCTGCTGCGG - Intronic
926168285 2:10535120-10535142 GTGGTCCCTGTACTCTGCTCTGG + Intergenic
926908919 2:17830916-17830938 GGTGCTCCTGGACTCTGCTGAGG + Intergenic
927465812 2:23335727-23335749 GAGGTTCAAGGTCTCTGCTGGGG - Intergenic
928082856 2:28325974-28325996 GGGAGTCCTGCACTTTGCTGTGG + Intronic
930570258 2:53077450-53077472 GGGGTTGATGGAAGCTGCTGGGG - Intergenic
930938717 2:56987355-56987377 GTGGTGTCTGGACTCTGCTAAGG + Intergenic
931655458 2:64507393-64507415 GGAGTTCCTGGAGTGGGCTGAGG - Intergenic
931746478 2:65295650-65295672 GGGGAGGCTGGGCTCTGCTGGGG + Intergenic
934331243 2:92072479-92072501 GGCATTCCTGGACTGTGATGTGG - Intergenic
935156369 2:100487082-100487104 AGTGTTGCTGGACACTGCTGTGG - Intergenic
936086132 2:109470651-109470673 GGGGTGCCTAGAAACTGCTGTGG + Intronic
937389908 2:121476292-121476314 GGGGCAGCTGGGCTCTGCTGGGG - Intronic
937495900 2:122418892-122418914 GGGGTTCATAGACTCTAATGAGG - Intergenic
937876151 2:126826966-126826988 GTGGTTTCTGGCCTCTGCAGAGG - Intergenic
937977701 2:127591773-127591795 GGGGTTCCAAGACTCTGCCATGG - Intronic
938516304 2:132010407-132010429 GGCATTCCTGGACTGTGATGTGG + Intergenic
943505793 2:188755805-188755827 TGGCTACCTGGACTCTTCTGTGG + Intronic
944880676 2:204009961-204009983 GTGGTTCCTGGAAACTCCTGGGG - Intergenic
945138630 2:206659002-206659024 GCTGTTCCTTGCCTCTGCTGTGG - Intronic
945315044 2:208361348-208361370 TGGGTTCCTGCAGTCAGCTGTGG + Intronic
947542243 2:230987198-230987220 GCGGTTCCGGGACTTTGCAGAGG + Intergenic
947914719 2:233823711-233823733 GGGGTCCCTGGATTCTTCTGGGG + Intronic
948200713 2:236128084-236128106 GAGGGTCCTGGGCTCTACTGGGG - Exonic
948787231 2:240358986-240359008 GTGGCTGCTGGACTCTGCAGGGG - Intergenic
948836701 2:240629392-240629414 AGCTGTCCTGGACTCTGCTGTGG + Intronic
949010558 2:241676032-241676054 GTGGGGTCTGGACTCTGCTGGGG + Exonic
1169112802 20:3044525-3044547 GGGGATCCTGGGCTGAGCTGAGG - Exonic
1169287437 20:4321455-4321477 GGGGCCACTGGACTCTGCTGTGG + Intergenic
1170040482 20:12034887-12034909 GGTGTTACTGGAGGCTGCTGAGG + Intergenic
1170884847 20:20331237-20331259 AGGATTCCTGCACTCTTCTGTGG + Intronic
1173608828 20:44351799-44351821 GGGGGGCCTGGACTCTGTCGTGG - Intergenic
1173824899 20:46041961-46041983 AGGCTTCCTGGACTCAACTGAGG + Intronic
1174511987 20:51060339-51060361 TGGGTTCCTGGCCTGTGATGGGG + Intergenic
1177989272 21:28018778-28018800 GGGCTTTCTACACTCTGCTGAGG - Intergenic
1179297543 21:40077175-40077197 GGGGTCCCTGGCCTCTGCACGGG - Intronic
1179453189 21:41479620-41479642 CAGGTTCCTGGACTGTGATGGGG + Intronic
1179721851 21:43320824-43320846 GGGGTGCCTGGGCTCTCTTGGGG - Intergenic
1179902136 21:44399823-44399845 GGGGTTCCAGGGCGATGCTGAGG - Intronic
1180047692 21:45317369-45317391 GGGGTTCCAGGCCCCTGTTGAGG - Intergenic
1181043154 22:20202402-20202424 AGGGTTCCTGGCCACTCCTGGGG + Intergenic
1182092970 22:27608643-27608665 GGGGTTCCTGGACACAGCCTGGG + Intergenic
1182658172 22:31906143-31906165 AGGGCTCCTGGAGCCTGCTGAGG - Intronic
1183186033 22:36292177-36292199 GGGGTGCCTGGAAACTGCTGAGG - Exonic
1184149526 22:42630242-42630264 GGGCTTTCTGGGGTCTGCTGCGG - Intronic
1184798289 22:46744680-46744702 GTGGTTCCTGGCCTCTGCCCTGG - Intergenic
1185071322 22:48658297-48658319 GGGATTCCGGGGCTCTTCTGAGG + Intronic
1185279799 22:49965184-49965206 GGTGTTTGTGGCCTCTGCTGTGG + Intergenic
1185289801 22:50017622-50017644 GTGGGGCCTGGACCCTGCTGAGG + Intronic
950013146 3:9737791-9737813 GGGGTTGCTGGAGCCTGATGGGG + Intronic
952410424 3:33044851-33044873 GGGGTTTCCTGTCTCTGCTGTGG - Intronic
953405023 3:42655710-42655732 GGGGTGGCTGAACCCTGCTGAGG + Intronic
954154811 3:48679506-48679528 GGTGTTCCTGCCATCTGCTGGGG - Intronic
955871516 3:63443184-63443206 CAGGTTCCTGTACTCAGCTGTGG + Intronic
960991879 3:123317230-123317252 GGTGTTTCTGAACTCTTCTGAGG - Intronic
961663294 3:128481646-128481668 GGGGTGCCTTGCCTCTGCTCAGG - Intronic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
962640855 3:137384906-137384928 GCTGTTCTTGAACTCTGCTGTGG + Intergenic
962661213 3:137602144-137602166 ACTGTTCCTGGAGTCTGCTGGGG + Intergenic
964644762 3:158947306-158947328 GGGGGTCCTGAACTCTGAGGAGG + Intergenic
966320390 3:178695250-178695272 GGGGGCCCTGGACTCAGCTCAGG + Intronic
967649836 3:191973243-191973265 TGGCTTCCTGCTCTCTGCTGAGG - Intergenic
968483697 4:848833-848855 GGGCCTCCTCGAGTCTGCTGTGG + Intergenic
968605369 4:1532718-1532740 GGGGTCCCTGGAGGCTGCTGGGG - Intergenic
968709430 4:2102251-2102273 GTGGATCCTGCACTCTGTTGGGG - Intronic
968818642 4:2834366-2834388 GGGGTTCCCGGGTACTGCTGCGG - Exonic
968905706 4:3449693-3449715 GAGGGGGCTGGACTCTGCTGGGG - Intergenic
970007673 4:11427241-11427263 TGGGTGCTTGGACACTGCTGAGG - Intronic
971188287 4:24402256-24402278 AGGGTTCTTGGACTCTGCAGCGG + Intergenic
971238876 4:24869365-24869387 TGGGCTCCTGGGCCCTGCTGTGG + Intronic
978024741 4:103859579-103859601 GGGTTTCATTGACTCTGTTGGGG + Intergenic
978566273 4:110085585-110085607 AGAGTCCCTGGACTCTGGTGAGG + Intronic
982370311 4:154626834-154626856 GCGGGTCCGGGACTCGGCTGGGG + Intergenic
982933681 4:161442168-161442190 GTGGTTTTTGGCCTCTGCTGAGG - Intronic
983909103 4:173216639-173216661 AGGGTTCCTGGGCTGGGCTGGGG + Intronic
989128097 5:38076195-38076217 GGGGTTAAACGACTCTGCTGGGG + Intergenic
989196480 5:38721599-38721621 GGGGTTCATGGAAAATGCTGAGG + Intergenic
990488386 5:56280758-56280780 GGGGGCCCTGGACCCTGATGAGG + Intergenic
990974935 5:61551615-61551637 GGGTTTCCTTGACTCAGGTGAGG - Intergenic
991416446 5:66397631-66397653 TGAATTCCTGGAATCTGCTGTGG - Intergenic
992466656 5:77012797-77012819 AAGGTTCCTGGCCTCTGCTATGG + Intergenic
992954019 5:81889592-81889614 GGGGTTTCTGCAGTCTCCTGAGG + Intergenic
995567759 5:113449515-113449537 TGGGTACCTGGCCTCCGCTGAGG - Intronic
997338595 5:133124927-133124949 ATGGCTCCTGGACTCTACTGGGG + Intergenic
998298286 5:140992999-140993021 GGGGATGCTGGACTCTGGGGAGG - Intronic
998564522 5:143204934-143204956 TGGGTTCCTGGGCTGGGCTGTGG + Intronic
998891483 5:146751006-146751028 GGGGATCCTGAACTCTGCCCTGG + Intronic
999476595 5:151905625-151905647 GGGGCTCCTTTACTCTGCTATGG - Intronic
999671567 5:153963280-153963302 GGGCTTCCTGGATTCAGCTGAGG - Intergenic
1000154535 5:158537599-158537621 GGGACTGCTGGATTCTGCTGAGG + Intergenic
1001245957 5:170106011-170106033 GGGGCTCCTGGCCGATGCTGGGG - Exonic
1001496090 5:172188407-172188429 GGGGTCCCGGGGCTCTGCCGGGG - Intergenic
1001649491 5:173305301-173305323 TTGGTTCCTGGACTGTGCTGGGG + Intergenic
1001683208 5:173573802-173573824 GGGCGTCCTGCAATCTGCTGAGG - Intergenic
1002198450 5:177513613-177513635 GGGGTCCCTGCAGTCTGATGTGG + Intronic
1003005796 6:2380395-2380417 GGGGTCCCTGGAGCCTACTGTGG + Intergenic
1003017951 6:2483078-2483100 GGGGTTCATGGACAATTCTGAGG + Intergenic
1005352699 6:24951971-24951993 GGGCTTCCTGTATTCTGCAGTGG + Intronic
1005697523 6:28365162-28365184 GAGGATCCAGGACTATGCTGGGG - Intronic
1006169321 6:32084097-32084119 GGGCTTCCTGTGCTGTGCTGAGG - Intronic
1006730160 6:36230558-36230580 GGGGCCCCCGGACTCTGCTCAGG - Exonic
1007083445 6:39125716-39125738 TGGGTTCCTGGGCTCTGCTCTGG - Intergenic
1007809377 6:44475575-44475597 AGGGTTCCTGGACAGAGCTGAGG - Intergenic
1012401916 6:98848230-98848252 GGGCCTCCTGGGCTGTGCTGGGG + Intergenic
1014736794 6:125103185-125103207 GTGCTCCCTGGACTGTGCTGTGG - Intergenic
1015707291 6:136102002-136102024 GTTGTTCCTGGTCTCTGTTGTGG + Intronic
1016977564 6:149824094-149824116 GGGGTTCCTGGGGTTTTCTGTGG - Intronic
1018472612 6:164109936-164109958 GGCGTTCCTGGACCCAGCAGTGG - Intergenic
1019594340 7:1851454-1851476 GGGCTTCCTGGGCACTGCTGGGG - Intronic
1023802387 7:43846262-43846284 GGGCTGCCTGGATTCTGCTTTGG - Intergenic
1024425926 7:49226587-49226609 GGGGATCCTAGATTCAGCTGAGG - Intergenic
1029734790 7:102459559-102459581 GGGGTTGCTGGGCTGCGCTGAGG - Intronic
1033589671 7:142798569-142798591 GGGGTTCCTGCAGTCAGCTGGGG + Intergenic
1033663344 7:143418797-143418819 GGGTTTCCAGGACTGTGCAGGGG + Intergenic
1034523360 7:151638223-151638245 GAGGTTACTGGACTCTAGTGTGG + Intronic
1035262094 7:157668535-157668557 GGGTTCACTGGGCTCTGCTGGGG + Intronic
1035336020 7:158127418-158127440 GGGTTTCCTGGTCTCTGGAGTGG - Intronic
1035470332 7:159105249-159105271 CGGCCTCCTGGGCTCTGCTGTGG - Intronic
1036760638 8:11506448-11506470 GGCGTTCCTGGCCTCTGGAGGGG + Intronic
1038610969 8:29059948-29059970 GGGTTTCCTGGTCTCTGCCTTGG - Intronic
1038971734 8:32644276-32644298 GGTGTTCCTGGGCTTTACTGGGG + Intronic
1039704137 8:39989873-39989895 AGGGGTCCTGGGCTCTGCTTAGG + Intronic
1039990218 8:42481471-42481493 TGGGTTCCTGGCCTAAGCTGGGG + Intronic
1040111420 8:43568644-43568666 GGGGTTCCCGGCCTCTTCTTTGG + Intergenic
1043922378 8:85998104-85998126 GGGGTTTCTGGGAACTGCTGAGG + Intronic
1044719903 8:95134423-95134445 GGGGGTCCTGGACACGGCCGGGG + Intronic
1044740435 8:95321059-95321081 GGTGTTCCTGGTTTCTCCTGAGG - Intergenic
1044919554 8:97154341-97154363 GTGGTTCCTGGGCTCTGCCTGGG + Intergenic
1045360935 8:101432669-101432691 CCAGTTCCTGGATTCTGCTGTGG + Intergenic
1045379009 8:101604352-101604374 GGGTTTGCTGCACTCTGCTCTGG - Intronic
1046198676 8:110893782-110893804 GGGGTCCCTGGGCTCTCCTCTGG + Intergenic
1047356900 8:124130255-124130277 GGGGTTCCAAGACTCAGCAGTGG + Intergenic
1049423773 8:142528292-142528314 GGGGTCCCTGCGCTCAGCTGAGG - Intronic
1050254348 9:3778629-3778651 GGGCTTCCGTGCCTCTGCTGAGG - Intergenic
1050965143 9:11790399-11790421 GTGGTTCCAGGACTCAGATGAGG + Intergenic
1055833288 9:80408176-80408198 GGGGTTCCTGGAGGATGATGTGG - Intergenic
1057407421 9:94785686-94785708 GGGGTTTCTGGCCTCTGCAGAGG + Intronic
1060757928 9:126226292-126226314 GGGGTTCTTGGAGAGTGCTGGGG - Intergenic
1060932399 9:127497288-127497310 GCAGTTCCTGGACTCTCCGGAGG - Exonic
1061130309 9:128704463-128704485 GTGGCTCCTGGACTCTACTTTGG + Intronic
1061385216 9:130285594-130285616 GGGTTGCCTGGACTTTGATGGGG - Intronic
1062265816 9:135685990-135686012 GGGGCTCCTGGTCACTGCAGGGG + Intergenic
1062416896 9:136455735-136455757 GGAGTGCCAGGACACTGCTGCGG + Exonic
1062707568 9:137953856-137953878 GAGGTGCCTGGGCTGTGCTGAGG + Intronic
1203783745 EBV:115654-115676 TGGGGTCCAGGAGTCTGCTGCGG - Intergenic
1187391138 X:18887285-18887307 GGGCTTCCTGGGCTTGGCTGGGG - Intergenic
1190880011 X:54485234-54485256 GGGGATCGTGGGGTCTGCTGGGG - Intronic
1191987235 X:66995000-66995022 TAGTTTCCTGGGCTCTGCTGGGG + Intergenic
1195421604 X:104681396-104681418 GGTGACCTTGGACTCTGCTGTGG + Intronic
1198932472 X:141876044-141876066 AGGGTTCCTGAATCCTGCTGAGG + Intronic
1200084780 X:153598846-153598868 GGGCTTCCCGGCCTCTGCTACGG + Intronic
1200212136 X:154351447-154351469 TGGGTTCCAGGCCTCTGCTCTGG - Intronic