ID: 1067769877

View in Genome Browser
Species Human (GRCh38)
Location 10:49115473-49115495
Sequence CGGCGGGGAGATGCGGCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067769877_1067769889 16 Left 1067769877 10:49115473-49115495 CCAGCAGCCGCATCTCCCCGCCG 0: 1
1: 0
2: 1
3: 19
4: 230
Right 1067769889 10:49115512-49115534 CGCGGGAGAGCGCCGCCGCCTGG 0: 1
1: 0
2: 0
3: 19
4: 139
1067769877_1067769885 -1 Left 1067769877 10:49115473-49115495 CCAGCAGCCGCATCTCCCCGCCG 0: 1
1: 0
2: 1
3: 19
4: 230
Right 1067769885 10:49115495-49115517 GCCGCCCGGCGCTGTGACGCGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1067769877_1067769890 21 Left 1067769877 10:49115473-49115495 CCAGCAGCCGCATCTCCCCGCCG 0: 1
1: 0
2: 1
3: 19
4: 230
Right 1067769890 10:49115517-49115539 GAGAGCGCCGCCGCCTGGCCCGG 0: 1
1: 0
2: 2
3: 19
4: 234
1067769877_1067769884 -2 Left 1067769877 10:49115473-49115495 CCAGCAGCCGCATCTCCCCGCCG 0: 1
1: 0
2: 1
3: 19
4: 230
Right 1067769884 10:49115494-49115516 CGCCGCCCGGCGCTGTGACGCGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067769877 Original CRISPR CGGCGGGGAGATGCGGCTGC TGG (reversed) Exonic
900786853 1:4654964-4654986 CGGCGCGGAGCTCCGGCTGGAGG + Intronic
902074818 1:13775879-13775901 CATCTGGGAGATTCGGCTGCAGG - Intronic
902578249 1:17392108-17392130 TGGCAGGGAGCTGCAGCTGCAGG + Exonic
902611049 1:17597369-17597391 CGGCTGGGAGAGGCTGCTCCGGG + Intronic
903857418 1:26345228-26345250 CGGGTGGGAGATGAGGCAGCAGG + Exonic
904754177 1:32759027-32759049 TGGTGGGGAGAGGAGGCTGCTGG + Intronic
904932907 1:34104605-34104627 CAGCGGGGAGCTGCAGATGCTGG + Intronic
906520898 1:46466455-46466477 AGGCCGGGCGATGCGGCCGCGGG + Intergenic
906731846 1:48089611-48089633 CAGCGGGGAGGTGGGGCTGCAGG - Intergenic
907905757 1:58782905-58782927 TGGCGCGGAGGTGCGGCTTCAGG + Exonic
908242412 1:62198520-62198542 CGGCGGGGTGGGGCGGCGGCGGG - Intronic
912954020 1:114140006-114140028 AGGCGGGGAGAAGCGGGTGAGGG + Intronic
915367329 1:155323526-155323548 CGGCGCCGGGCTGCGGCTGCTGG + Intronic
915489170 1:156242002-156242024 TGGTTGGGAGCTGCGGCTGCTGG - Exonic
916694313 1:167221068-167221090 CGGCGGGGAGATGGGGGGCCGGG + Intronic
919746672 1:201013334-201013356 GGGCCGGGAGAAGAGGCTGCTGG - Intronic
1067769877 10:49115473-49115495 CGGCGGGGAGATGCGGCTGCTGG - Exonic
1067937334 10:50623486-50623508 CAGCGGGGAGGTCCGGCGGCCGG - Intronic
1072753168 10:97999075-97999097 CAGCAGGGAGGTGCAGCTGCAGG + Intronic
1073733546 10:106320172-106320194 CAGCGGGGAGGTGTGGGTGCTGG + Intergenic
1075645159 10:124092291-124092313 AGGCGGGGAGCCGGGGCTGCGGG - Intronic
1075955568 10:126520247-126520269 CGGCTGGGAGATGAGGCTGGTGG - Intronic
1076392282 10:130111671-130111693 GGGCCTGGACATGCGGCTGCAGG - Intergenic
1077014750 11:394557-394579 TGGCGGGGAGAGGTGGCTGCGGG + Intronic
1077090544 11:776597-776619 GGACGGGGAGATGGGGCTGTGGG - Intronic
1078987060 11:16607066-16607088 TGGCCGGGAGCCGCGGCTGCCGG - Intronic
1079231312 11:18651222-18651244 CGGGAGGAAGCTGCGGCTGCTGG + Intergenic
1083265719 11:61546075-61546097 AGGCGGGGAGAGGCCGCTGGCGG - Exonic
1084582431 11:70032342-70032364 CGTCGGGGAGAGGCGGGTGCAGG + Intergenic
1084604101 11:70162470-70162492 GGGTGTGGAAATGCGGCTGCTGG + Intronic
1085157679 11:74311422-74311444 CGGGGAGGAGGCGCGGCTGCGGG - Exonic
1085312704 11:75525706-75525728 CGGCGGGGAGGCGCGGCGGCCGG + Exonic
1090733492 11:129591528-129591550 GGGTGGGGAGTTGCAGCTGCAGG - Intergenic
1096389388 12:51217448-51217470 CGGCGGGGAGCTGCGGGAGCGGG - Intronic
1101606032 12:106248123-106248145 CGGCGGGGAGGAGGGGCCGCCGG - Intronic
1101962121 12:109258371-109258393 GGGCCGGGAGCTGTGGCTGCTGG + Intronic
1102003564 12:109573831-109573853 CGGCGCGGAGGGGCGGCGGCCGG + Exonic
1102225709 12:111226933-111226955 CGGTGGGGAGATAAGGCCGCTGG + Intronic
1102743484 12:115229207-115229229 CTGAGAGAAGATGCGGCTGCTGG - Intergenic
1102933552 12:116879751-116879773 CCGCGGGGAAAGGCGGCAGCCGG - Intronic
1103719566 12:122966111-122966133 GGGCTGGGAGCTGCGGCTGCGGG + Intronic
1103782817 12:123410550-123410572 TGGAGGGGACATGTGGCTGCTGG + Intergenic
1103928825 12:124438288-124438310 CCGTGGGCAGATGTGGCTGCCGG - Intronic
1104444738 12:128823950-128823972 CGGCGGGGCGAGGCAGCTGGCGG - Exonic
1104857423 12:131908621-131908643 CTGCGGGGAGAGGCGGCTCAGGG - Intronic
1104913614 12:132252299-132252321 CGTGGCGGGGATGCGGCTGCAGG - Intronic
1105474959 13:20721284-20721306 CGGCGGGAAGCAGCGGCTCCGGG + Intronic
1105799509 13:23891378-23891400 CGGGGATGAGATGTGGCTGCAGG - Exonic
1110933020 13:81246890-81246912 GGGCAGGCAGGTGCGGCTGCTGG + Intergenic
1115248394 14:31320175-31320197 TGGCGCGGAGTTGCAGCTGCAGG + Intronic
1115769598 14:36656061-36656083 TGGCCGGGAGAGGCGGCTGGGGG + Intergenic
1117441728 14:55766400-55766422 CGGCCAGAAGATGCGGCTGGGGG - Intergenic
1118619322 14:67600288-67600310 GGGCGTGGTGACGCGGCTGCCGG - Intergenic
1127259733 15:57319336-57319358 AGGTGGGGAGAAGCGGCTGACGG + Intergenic
1128633658 15:69289046-69289068 GAGCGTGGAGATGCTGCTGCCGG + Intergenic
1129120926 15:73396150-73396172 CGGCGGGGAGCTGGGGATGAGGG - Intergenic
1129220295 15:74128434-74128456 CGGCAGGGAGACGGGGCTCCTGG - Exonic
1129410304 15:75347408-75347430 CGCCGGCGAGATGCGGGGGCAGG - Exonic
1130994238 15:88895229-88895251 CGGCGCGGGGATGCGGGCGCCGG - Intronic
1131259015 15:90878999-90879021 GGCTGGGGAGATGGGGCTGCTGG + Intronic
1132583296 16:694937-694959 CGGCGGGGAGGTGGGGGCGCGGG - Intronic
1133036164 16:3035511-3035533 CTGCGGGGACAGGTGGCTGCGGG + Exonic
1135993383 16:27230874-27230896 TGGCGGTGAGCTGTGGCTGCAGG - Intronic
1136285321 16:29237216-29237238 CGGCGGGGAGGCGAGGCCGCGGG + Intergenic
1136285330 16:29237241-29237263 CGGCGGGGAGGCGAGGCCGCGGG + Intergenic
1136285339 16:29237266-29237288 CGGCGGGGAGGTGAGGCCGCGGG + Intergenic
1136453866 16:30369862-30369884 CGGAGGGGAGCTGCGGCTTTGGG + Exonic
1137031739 16:35531194-35531216 CTCAGGGGAGATGCTGCTGCTGG - Intergenic
1137267982 16:46884374-46884396 GGGCGCGGGGATGCGGCTGTGGG + Exonic
1137615537 16:49844445-49844467 CGGCTGGGAGAGGCTGATGCCGG - Intronic
1137668194 16:50263811-50263833 CGGCGTGGAGATGGAGCCGCTGG - Intronic
1137988682 16:53131150-53131172 TGGTGGGGAGATGCGGGGGCGGG + Intronic
1138417646 16:56880335-56880357 CGGCGGGGAGATGAGGAGACAGG - Intronic
1138514549 16:57528943-57528965 CCGCGAGGAGCTGCGGCTGCGGG - Exonic
1138548575 16:57734893-57734915 CAACAGGGAGAGGCGGCTGCGGG + Intergenic
1140393282 16:74606775-74606797 CGGCGGGGAGGAGCGGGGGCTGG - Exonic
1140927566 16:79599146-79599168 CGGCGGCGTGGTGCGGGTGCAGG + Exonic
1141018335 16:80470815-80470837 TGGCCTGGAGATGCAGCTGCAGG + Intergenic
1141812520 16:86385114-86385136 CGGCGGGGAGCTGCCGGGGCAGG - Intergenic
1141950316 16:87335424-87335446 CGGCAGGTAGATGCGGCGGTAGG + Exonic
1142013668 16:87731600-87731622 TGGCGAGGACATGGGGCTGCTGG + Intronic
1142356738 16:89604938-89604960 GGGTGGGGAGCAGCGGCTGCGGG + Intergenic
1142586873 17:979479-979501 CTGCGGGGGGACGCGGCGGCCGG - Exonic
1143590768 17:7885009-7885031 CGGCGGGAAGAGGTGGCAGCCGG - Exonic
1144877791 17:18411423-18411445 CGGCGGGAAGACGCTGCTGGGGG - Intergenic
1145154430 17:20532966-20532988 CGGCGGGAAGACGCTGCTGGGGG + Intergenic
1146473039 17:33139654-33139676 AGGAGGGGACATGCTGCTGCAGG - Intronic
1147134835 17:38428683-38428705 CTGCGGGGAGATTCAGCTGGTGG + Intronic
1151491241 17:74433215-74433237 CGGCGGGGAGAGGAAGCTCCAGG - Intronic
1151705487 17:75764922-75764944 CGGCCGGGACAGGCGGCGGCGGG + Intronic
1151951401 17:77356279-77356301 AGGCAGGGAGATGGGGCTGGAGG - Intronic
1152584091 17:81181444-81181466 GGGCGGGGACATGGGGGTGCAGG + Intergenic
1152747459 17:82048002-82048024 AGGCGGGGAGGTGGGTCTGCTGG + Exonic
1155020953 18:21896814-21896836 GGGAGGGGAGATGGGGCTGAAGG - Intergenic
1155654348 18:28177114-28177136 CGGCGCGGAGAAACGGCTCCAGG + Exonic
1156036539 18:32771857-32771879 CAGAAGGGAGCTGCGGCTGCAGG - Intronic
1156452506 18:37274731-37274753 CGGCGGGGCGTGGCGGGTGCTGG + Intronic
1159045697 18:63367106-63367128 CCGCGGAGCGATGCTGCTGCTGG - Exonic
1160030138 18:75250335-75250357 CTGCGGGGAGAAGCTCCTGCCGG - Intronic
1160752334 19:740294-740316 CGGCGGGGGGGTGCGGGGGCGGG + Intronic
1161031779 19:2061099-2061121 GGGCAGGGAGATGCGGCTGGGGG + Intergenic
1162315537 19:9936272-9936294 CGGCGGGCAGGTGCGGGCGCGGG - Intronic
1163034257 19:14562330-14562352 CGGCCGGCAGCTGGGGCTGCTGG + Intronic
1163674934 19:18650923-18650945 CTGCAGGGAGAGGCGGCAGCTGG + Intronic
1163695069 19:18759934-18759956 CGGCGGGGACAGGGGGCTGGCGG - Intronic
1164536162 19:29087858-29087880 AGACAGGGAGATGCGGCTGGAGG + Intergenic
1164958407 19:32405999-32406021 CGGCGGGGAGGGGCGGCCCCAGG - Intronic
1164965977 19:32484440-32484462 TGGCGGGGAGCTGCTGCCGCGGG - Exonic
1165061410 19:33206944-33206966 GGGCGGGGGGATGCGGCTGAGGG - Intronic
1165120596 19:33556258-33556280 GGGCGGGGAGCTGGGCCTGCAGG + Intergenic
1165730196 19:38140283-38140305 AGGCGGGGAGATCCGCCGGCTGG - Intronic
1166811609 19:45517828-45517850 CGGCGGGAAGCTGCACCTGCTGG - Exonic
1167002853 19:46756137-46756159 CGGCTGGGCGGTGCAGCTGCTGG + Exonic
1167696364 19:51017611-51017633 CGGCGGGGAGGTAAGGGTGCGGG + Intronic
1168417384 19:56177172-56177194 CGGTGGGCAGGTGCGGATGCTGG - Exonic
1168636737 19:58002695-58002717 CGGCTGGGAGAGGCGGCGTCAGG - Exonic
925391829 2:3500524-3500546 CGGCAGGTACATGCGGCGGCAGG - Intronic
925926575 2:8675409-8675431 TGGCGAGGAGATGCTGATGCCGG - Intergenic
926154987 2:10448573-10448595 GGGCGGGGAGAGGCGGCCGCAGG - Intergenic
926155000 2:10448603-10448625 GGGCGGGGCGAGGCGGCCGCAGG - Intergenic
929107205 2:38377001-38377023 CGGCGGGCAGGCGCGGCGGCGGG + Intronic
931614627 2:64143958-64143980 GGGCGGGGAGAGCCGGCTGCTGG + Intronic
931878044 2:66535541-66535563 GGGCAGGGAGGTGCGGATGCCGG - Intronic
932314135 2:70768330-70768352 CTGCGGGGCGAGGCCGCTGCGGG - Intergenic
934490618 2:94760126-94760148 CTGAGGGGAGATGCTTCTGCAGG - Intergenic
937221948 2:120346836-120346858 CGGCGGGGGGTTGAGGCAGCAGG - Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
941905957 2:170716323-170716345 CGGCTGGCCGATGCGGCTACAGG - Exonic
944221724 2:197310404-197310426 CGGAGGGGAGCTGCCGCCGCGGG + Intronic
944412447 2:199457738-199457760 CGGCGGCGAGCCGGGGCTGCTGG + Exonic
948126422 2:235567675-235567697 TGGTGGGGAGAAGGGGCTGCAGG + Intronic
948169541 2:235889992-235890014 AGGCTGGGAGATGTGGCTGTGGG - Intronic
948753626 2:240146258-240146280 TGGCGGGGAGAAGGGGCTCCAGG + Intergenic
1173489784 20:43470434-43470456 CGGCGCGGAAAAGAGGCTGCAGG - Intergenic
1174432919 20:50483659-50483681 GGGCAGAGAGATGCGGGTGCCGG + Intergenic
1175077979 20:56392091-56392113 CGGCGGGGACAAGGGGCGGCTGG - Exonic
1175199323 20:57266837-57266859 CGTCGCGGGGATGCGGCTGGAGG + Intergenic
1175988294 20:62775235-62775257 CAGGGGGGAGATGCACCTGCTGG + Intergenic
1176145060 20:63561877-63561899 CCGTGGGGAGAAGCGGCTGGGGG - Exonic
1176149021 20:63579463-63579485 GGGAGGGGAGAGGCGGCTGAAGG + Intergenic
1178432155 21:32526183-32526205 AGGCGGGGAGATGCTGATGGGGG - Intergenic
1178865190 21:36320725-36320747 GGGCGGGGGGACGGGGCTGCGGG + Intronic
1179879753 21:44288469-44288491 TGGCGGGGAGATGGGGCTGATGG + Intronic
1179902574 21:44401675-44401697 CCGCAGGGAGAAGAGGCTGCAGG + Exonic
1180042858 21:45288711-45288733 CTGCGGGGAGCGGCGGCGGCGGG - Intergenic
1181109178 22:20591371-20591393 GGGGAGGGAGATGAGGCTGCAGG + Intergenic
1181486732 22:23236287-23236309 CAGGGTGGAGATGAGGCTGCAGG - Intronic
1182015102 22:27032665-27032687 CGGCGGGCAGATGGGTATGCTGG - Intergenic
1183213246 22:36463881-36463903 CGGAGAGGAACTGCGGCTGCAGG + Intergenic
1183432178 22:37772504-37772526 CTGCGGGGAGGTCTGGCTGCTGG + Intronic
1183665075 22:39242403-39242425 CGGCGAGGCGAGGCGGCAGCTGG + Intronic
1183709165 22:39492327-39492349 CAGTGGGGAGAGGGGGCTGCAGG + Intergenic
1184236673 22:43186857-43186879 CGGCGGGCACGTGCGGCGGCCGG - Intronic
1184308994 22:43628938-43628960 CGTCTGTGAGATGGGGCTGCTGG + Intronic
1185248476 22:49786358-49786380 GGGCGGGGAGCAGAGGCTGCAGG + Intronic
1185296855 22:50058711-50058733 CGGCGGGGTGAGGAGGCCGCGGG + Intergenic
950436148 3:12981456-12981478 TGGGGGGGAGAACCGGCTGCTGG + Intronic
950670695 3:14523728-14523750 CGGCCTGGAGATGCGACTGAGGG - Intronic
951520416 3:23606101-23606123 CGGGGAAGAGATGCTGCTGCAGG + Intergenic
952788240 3:37176562-37176584 GGGCGGCGAGGCGCGGCTGCCGG + Intronic
954063578 3:48088756-48088778 CGGCGGGTAGGTGCAGCCGCAGG - Exonic
954396775 3:50297191-50297213 CAGGCGGGAGGTGCGGCTGCGGG + Exonic
961550805 3:127669694-127669716 CTGCGGTGAGATGCGGCGCCTGG + Intronic
963236842 3:142964028-142964050 GGGCGGGGAGCTGCGGCTGCGGG + Intergenic
963253424 3:143121293-143121315 CGTCGGGGACAAGCGGCAGCTGG + Exonic
966411825 3:179653073-179653095 GGGCGGGGAGAGCGGGCTGCGGG - Exonic
966866140 3:184260080-184260102 CGGGCCGGCGATGCGGCTGCCGG - Exonic
967108681 3:186273828-186273850 CACCGGGGAGCTGCTGCTGCAGG - Intronic
968151171 3:196337857-196337879 CGGGGGAGAGATTCGGCTGAGGG - Intronic
968323470 3:197791597-197791619 CGGCCGGGGGAGGCGGATGCGGG + Intronic
968470880 4:781778-781800 AGGCGGGAAGGTGCGGCCGCGGG + Intergenic
968503062 4:960109-960131 GGGCGGGGAGGTGAGGCTGGAGG + Exonic
968879729 4:3292892-3292914 GGGCGGGGCGATGCGGGGGCGGG - Intergenic
972272802 4:37528374-37528396 CTTGGGTGAGATGCGGCTGCAGG - Intronic
979448272 4:120839880-120839902 CAGCGGGGAGCTGAGGCAGCAGG + Intronic
981713656 4:147732486-147732508 CGGCGTGGCGAGGCGGCTGGGGG + Intronic
985727500 5:1523832-1523854 CGGCGCGGCCATGAGGCTGCGGG - Exonic
988176239 5:27729577-27729599 CGGCGGGTAGCTGGGACTGCAGG + Intergenic
992550148 5:77852015-77852037 CGGCGGCGCGAGGAGGCTGCGGG - Intronic
996900770 5:128538914-128538936 CGGCGGGGAAGTTCAGCTGCGGG - Intronic
997472306 5:134123811-134123833 AGGCGGGGAGAGCCAGCTGCTGG + Intronic
1001589925 5:172858234-172858256 CGGCCGGCTGAAGCGGCTGCTGG + Intronic
1002080287 5:176733534-176733556 CGGACGGGAGATGGGGCTGGGGG - Intergenic
1003156949 6:3604976-3604998 CAGCTGGGAGATGTGGTTGCTGG - Intergenic
1003325086 6:5085185-5085207 GGGCGGGGAGGCGCGGCCGCTGG - Exonic
1006367136 6:33622241-33622263 AGGCGGGGAGAAGGGGCAGCTGG - Intronic
1006814296 6:36840000-36840022 CGGCGGGAGGCTGCGGCTTCGGG - Exonic
1007829942 6:44630304-44630326 CTGCGGGGAGAAGCTGCTCCTGG + Intergenic
1010399961 6:75437021-75437043 GAGCGGGGAGTTGAGGCTGCAGG - Intronic
1012450593 6:99349624-99349646 CGGGGCGGAGAGGCAGCTGCGGG - Exonic
1013459066 6:110358132-110358154 CGGCGGGGCGCTGCGGGTGGGGG + Exonic
1017146514 6:151240258-151240280 CTGGGGGCAGATGCTGCTGCAGG + Intronic
1018935711 6:168272814-168272836 AGGTGGCGAGATGCGCCTGCTGG - Intergenic
1018994988 6:168703774-168703796 GGGCTGTGAGATGGGGCTGCAGG + Intergenic
1019337178 7:491021-491043 GGGCTGGGAGATGTGGCTGTGGG - Intergenic
1019459329 7:1148081-1148103 CAGCGGGGAGAGGCGGCGCCTGG - Intergenic
1019755081 7:2762897-2762919 CGGCGGGGAGAAGAGGCCACAGG + Intronic
1019982496 7:4631741-4631763 AGTCGGGGAGAAGCTGCTGCGGG + Intergenic
1020106247 7:5423538-5423560 CGGAGGGGAGCGGCGGCCGCGGG - Exonic
1024640672 7:51326212-51326234 CTGAGTGGAGATGGGGCTGCTGG + Intergenic
1025032863 7:55571947-55571969 CGGCGGGGAGAGGGGGCGGACGG + Intronic
1025320220 7:58087388-58087410 CGGCAAAAAGATGCGGCTGCGGG - Intergenic
1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG + Exonic
1026840399 7:73667677-73667699 GGGCGGGGAGATCGGGTTGCTGG + Intergenic
1028347239 7:89798202-89798224 AGGGAGGGAGATGGGGCTGCTGG + Intergenic
1029113997 7:98228117-98228139 CTGTGGGGAGAGGTGGCTGCTGG + Intronic
1029458707 7:100683644-100683666 AGGGGGGCAGAGGCGGCTGCAGG + Intronic
1029540373 7:101179269-101179291 CGGACAGGAGATGCGGCCGCAGG + Intronic
1030033566 7:105389218-105389240 CGGAGGGGAGAGGCCGCGGCGGG - Intronic
1033652081 7:143351306-143351328 CAGTGGGGGGATGTGGCTGCAGG + Intronic
1034901935 7:154913440-154913462 GGGTGGGGAGAGGCCGCTGCAGG - Intergenic
1034997487 7:155587292-155587314 CCGCAGGGCGACGCGGCTGCGGG - Intergenic
1035275178 7:157743986-157744008 TGACGGGGCGATGCTGCTGCAGG + Intronic
1036618313 8:10405241-10405263 AGGTGGGGAGCTGCAGCTGCAGG + Intronic
1049104221 8:140601348-140601370 CGGGGGGGTGCTGGGGCTGCTGG - Intronic
1049109800 8:140635655-140635677 CGGCGGGCGGAGGCGGCGGCGGG + Intergenic
1049235034 8:141508120-141508142 CGGCCGGCAGATGGCGCTGCGGG + Intergenic
1049434714 8:142581168-142581190 GTGCGGGGAGAGGCGGCTGCTGG + Intergenic
1049445191 8:142626985-142627007 GGGTGAGGAGATGGGGCTGCAGG - Intergenic
1049741355 8:144242540-144242562 CGCAGGGGAGCTGGGGCTGCCGG + Intronic
1049762328 8:144337048-144337070 CCGCAGGCAGAGGCGGCTGCGGG - Intergenic
1049770107 8:144375998-144376020 CTTCTGGGAGATGCAGCTGCAGG + Intronic
1049847012 8:144807722-144807744 CAGCCGGGAGCTGCGGCTGAAGG - Exonic
1052824822 9:33167157-33167179 CGGCGGGAAGATGAGGCTTCGGG - Exonic
1053494823 9:38542450-38542472 CTGAGGGGAGATGCTTCTGCGGG - Exonic
1053667369 9:40325566-40325588 CTGAGGGGAGATGCTTCTGCAGG + Intronic
1053916947 9:42950670-42950692 CTGAGGGGAGATGCTTCTGCAGG + Intergenic
1054378514 9:64465594-64465616 CTGAGGGGAGATGCTTCTGCAGG + Intergenic
1054517241 9:66050719-66050741 CTGAGGGGAGATGCTTCTGCAGG - Intergenic
1057444420 9:95103806-95103828 CTGTGGGCAGATGGGGCTGCAGG + Intronic
1057883103 9:98807959-98807981 GGGCGAGGAGCTGCGGCTGCAGG + Exonic
1058851202 9:109013457-109013479 CGGCGCGGAGTCCCGGCTGCGGG - Exonic
1060431570 9:123555399-123555421 GGGTGGGGAGATGGGGCTGCAGG - Intronic
1060856044 9:126915297-126915319 GGGCGGGGCGCCGCGGCTGCAGG + Intronic
1061262634 9:129488542-129488564 GGGCGTGGAGAGGCGGCCGCGGG - Intergenic
1062049193 9:134438444-134438466 CGGCGGGGAGGAGAGGCTTCTGG - Intronic
1062063832 9:134515249-134515271 CGGTGGGGAGATGGGGCCGGAGG - Intergenic
1062094209 9:134694702-134694724 CACCAGGGAGATGAGGCTGCAGG + Intronic
1062173980 9:135150839-135150861 GCCGGGGGAGATGCGGCTGCAGG - Intergenic
1062180241 9:135187518-135187540 CGGCGGGGAGGTAGGGCTGTGGG + Intergenic
1062206018 9:135337812-135337834 AGGCAGGGAGACGCAGCTGCAGG - Intergenic
1062253069 9:135608070-135608092 CTGCGGGGACATGGGGCTGCAGG - Intergenic
1062533864 9:137013167-137013189 CAGCGGGGAGTCGCGCCTGCTGG - Exonic
1187403654 X:18984135-18984157 CGGCGGGGAGGCGCGGGGGCGGG + Exonic
1188833654 X:34931458-34931480 TGGAGGGGAGATACGGATGCTGG + Intergenic
1198683205 X:139203584-139203606 GGGCGGGGAGAGGGGGCTGAAGG + Intronic
1199595837 X:149505165-149505187 CGGCGGGGACAGGCTGCAGCAGG + Intronic
1200182343 X:154158400-154158422 CGGGAGGGAGAAGCAGCTGCAGG + Intronic
1200187997 X:154195514-154195536 CGGGAGGGAGAAGCAGCTGCAGG + Intergenic
1200193647 X:154232654-154232676 CGGGAGGGAGAAGCAGCTGCAGG + Intronic
1200199402 X:154270458-154270480 CGGGAGGGAGAAGCAGCTGCAGG + Intronic