ID: 1067773847

View in Genome Browser
Species Human (GRCh38)
Location 10:49147070-49147092
Sequence CTCAAAAAGAAGTTGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067773847_1067773851 25 Left 1067773847 10:49147070-49147092 CCCAGGCTCAACTTCTTTTTGAG No data
Right 1067773851 10:49147118-49147140 AGAAAATAACCCATTTTATCTGG No data
1067773847_1067773850 1 Left 1067773847 10:49147070-49147092 CCCAGGCTCAACTTCTTTTTGAG No data
Right 1067773850 10:49147094-49147116 AAACATAGTCATTTAAATTTGGG No data
1067773847_1067773849 0 Left 1067773847 10:49147070-49147092 CCCAGGCTCAACTTCTTTTTGAG No data
Right 1067773849 10:49147093-49147115 CAAACATAGTCATTTAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067773847 Original CRISPR CTCAAAAAGAAGTTGAGCCT GGG (reversed) Intergenic
No off target data available for this crispr