ID: 1067774756

View in Genome Browser
Species Human (GRCh38)
Location 10:49155053-49155075
Sequence CTACAATTGCCATCAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067774756 Original CRISPR CTACAATTGCCATCAGGCTA AGG (reversed) Intronic
906791093 1:48659322-48659344 CTACCATTTCCATCTAGCTAGGG - Intronic
909615598 1:77605325-77605347 GAACAATTGCCCTCTGGCTAGGG - Intronic
911887944 1:103327342-103327364 CTGCAATTCCCCTCTGGCTAGGG + Intergenic
912968525 1:114258558-114258580 CTACAGTAGCCCTCAGGCTGAGG + Intergenic
923344862 1:233041972-233041994 ATAAAATTGCCTTCATGCTATGG + Intronic
1063408066 10:5815044-5815066 TCACAATTGCCATCAGCCTCTGG + Intronic
1067774756 10:49155053-49155075 CTACAATTGCCATCAGGCTAAGG - Intronic
1068945053 10:62721408-62721430 GTACAATTTCCATGAGGGTAAGG + Intergenic
1072437561 10:95427968-95427990 CTCCCATTGCCACCATGCTAGGG + Intronic
1076925410 10:133481315-133481337 CTACAAGTGCCATCAGGTAAAGG - Intergenic
1079622168 11:22567711-22567733 CTCCTATTGCCCTCAGGCTTGGG - Intergenic
1080241646 11:30133861-30133883 CTCCAATTGCCATCACACTGGGG + Intergenic
1080898872 11:36468403-36468425 CTTCATTTTCTATCAGGCTAGGG - Intergenic
1083766796 11:64845086-64845108 CTACAATTCCCATCCGGCTCCGG - Intergenic
1095163221 12:38941150-38941172 GGACAATTCCCATCTGGCTAGGG - Intergenic
1096918399 12:55057833-55057855 CTAGAGTTGCCTTCAGGCCAAGG - Intergenic
1100165728 12:91915376-91915398 CTACAATTCCCAATAGCCTAGGG + Intergenic
1106886838 13:34195731-34195753 CTAAAATTGCTATCTGGCCAAGG + Intergenic
1109927497 13:69163811-69163833 GTAAAATTACCTTCAGGCTATGG - Intergenic
1110079040 13:71287361-71287383 CTGCAATTTCCTTCTGGCTATGG + Intergenic
1111759943 13:92450394-92450416 CTACAATTAGCTTCAGGTTATGG - Intronic
1112079534 13:95954156-95954178 CTAAAATTACCTTCAGTCTATGG + Intronic
1123507703 15:20961346-20961368 CTACAGGTGCCTTCAGGCTTAGG + Intergenic
1123564924 15:21535086-21535108 CTACAGGTGCCTTCAGGCTTAGG + Intergenic
1123601184 15:21972380-21972402 CTACAGGTGCCTTCAGGCTTAGG + Intergenic
1126368926 15:47925397-47925419 CTACAACTGCCAGCAGGCACAGG - Intergenic
1128508492 15:68298215-68298237 CTAAACTTGCCAACAAGCTAAGG - Intronic
1202973292 15_KI270727v1_random:262199-262221 CTACAGGTGCCTTCAGGCTTAGG + Intergenic
1135544706 16:23357856-23357878 CCACACCTGCCATAAGGCTAGGG + Intronic
1137988233 16:53128558-53128580 CTACCATTTCCACCAGGCAATGG - Intronic
1138044192 16:53703899-53703921 CTACATTTCCCAGGAGGCTACGG - Intronic
1146555112 17:33816570-33816592 CAACAGTTGGCATCAGGGTAGGG - Intronic
1153376953 18:4391564-4391586 CTTCAATTTCCTTCAAGCTAAGG - Intronic
1156769367 18:40700271-40700293 AAACATTTGTCATCAGGCTAGGG + Intergenic
1157197739 18:45633132-45633154 CTACATTTGCCATCAGTTTATGG + Intronic
1166109220 19:40612430-40612452 TCACAATTGCTATCAGGGTATGG - Intronic
1168108397 19:54178646-54178668 CTACAATTCCCATGAGCCTCCGG + Intronic
1168242773 19:55095689-55095711 CTACAATTCCCATCAGCCCCCGG + Intronic
1168261521 19:55197684-55197706 CTACAGTTCCCATGAGGCTATGG + Intronic
925251732 2:2444800-2444822 TTACCATTGCTATCAGGCCAGGG - Intergenic
926654307 2:15383785-15383807 CCACATTTGCCATCAGTCTGGGG + Intronic
927309878 2:21618085-21618107 CTGCAATTCCCCTCTGGCTAGGG + Intergenic
928628443 2:33165362-33165384 CTACAATTGGCATCTGGTTATGG + Intronic
936439898 2:112542380-112542402 CTACATTTCCCAGCAGGCTGCGG + Exonic
940984024 2:160035002-160035024 ATAAAATTACCTTCAGGCTATGG + Intronic
941978947 2:171434196-171434218 CTACAATTCCCGTCAGGCGGCGG - Intronic
943695071 2:190918474-190918496 CTACAATTTCCCTTAGGCCAAGG - Intronic
944536337 2:200713890-200713912 CTCCAATTTCCATCAGTCAAGGG + Intergenic
946771790 2:223096327-223096349 AAACAATTGCCGTCAGGCTTTGG - Intronic
1170107491 20:12767501-12767523 GGACAATTGCCAGCAGGCTATGG + Intergenic
1173504318 20:43575024-43575046 CTACAAGGGCCATCTGGCTAGGG + Intronic
1177393742 21:20507873-20507895 CCACCACTGCCCTCAGGCTAGGG - Intergenic
1181855027 22:25775251-25775273 CTACATCTGGCATCAGGATAGGG + Intronic
949305806 3:2639334-2639356 TTGCACCTGCCATCAGGCTATGG + Intronic
949461913 3:4303269-4303291 CTACAATTCCCATGAGGCGGTGG + Intronic
950844182 3:15998718-15998740 CTAAAATTGCCTTCAGAGTAAGG + Intergenic
951102360 3:18703621-18703643 CTACCATTACCAACAGGCCATGG - Intergenic
951376882 3:21928982-21929004 CTACAATTTCCACAATGCTAAGG + Intronic
953223946 3:40999371-40999393 CAACAATTCCCATCAGTCGATGG - Intergenic
955844714 3:63150118-63150140 ATACCATTGACATCAGGGTAGGG + Intergenic
956061004 3:65348329-65348351 ATTCAATCCCCATCAGGCTATGG + Intergenic
960521276 3:118658315-118658337 TTACAATTCCCCTCTGGCTAGGG + Intergenic
972863463 4:43201463-43201485 TTACAAATGCCATCAGGTTGGGG - Intergenic
973340413 4:48997634-48997656 CTAAAATTGTCCTCAGGCTCTGG - Intronic
976040991 4:80885173-80885195 GGGCAATTGCCATCTGGCTAGGG - Intronic
976482036 4:85556779-85556801 CTCCTATTGCCCTCAGGCTCAGG - Intronic
977002260 4:91518996-91519018 CTCTAACTACCATCAGGCTAGGG - Intronic
977438680 4:97035284-97035306 CTTCAATTGCCTTCAGGGCAGGG + Intergenic
983983719 4:174031754-174031776 CTACAATTTCCATCAGTCACTGG + Intergenic
984145316 4:176053334-176053356 CAACTATTGTCAACAGGCTAAGG + Intergenic
986754583 5:10823812-10823834 CTACAATGGCCATCCGGCATTGG + Intergenic
988941478 5:36152039-36152061 CTACAATTCCCAGCAGGCCTTGG + Intronic
991018782 5:61958791-61958813 CCACAATTCCCCTCCGGCTAGGG + Intergenic
993612497 5:90072465-90072487 CTACAATTGCCTTAAAACTAAGG - Intergenic
993634514 5:90327154-90327176 CTCCAATTGCTCTCAGGCTCAGG - Intergenic
996304297 5:122029025-122029047 CTACAAGAGCCATTAGTCTAGGG + Intronic
998921344 5:147071563-147071585 GTACAATTGCCCTGAGGCAAGGG - Intronic
1002951393 6:1815840-1815862 CAAGAATTGACATCAGGATAAGG - Intronic
1004798094 6:19112212-19112234 CTGGCTTTGCCATCAGGCTAAGG + Intergenic
1009858206 6:69291702-69291724 CTTCATTTGCCATGAGGTTAGGG - Intronic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1015838884 6:137454637-137454659 TAACAATTGCCATCATGCTGAGG + Intergenic
1018307569 6:162473784-162473806 CCACACTTGCCATCAGTTTATGG - Intronic
1025611113 7:63076384-63076406 CTCCAGGTGCCATCAGGCTTTGG + Intergenic
1027267160 7:76500762-76500784 CCAGGATGGCCATCAGGCTATGG - Intronic
1027318972 7:77000630-77000652 CCAGGATGGCCATCAGGCTATGG - Intergenic
1030024058 7:105304851-105304873 CTACAGATGCCCTCAGACTAGGG + Intronic
1031317707 7:120276476-120276498 CTACAGATCCCATCAGGCAATGG + Intronic
1032480544 7:132243036-132243058 GTTCAATTGCCATTAGGCTTTGG - Intronic
1032693707 7:134315518-134315540 ATACAATTACCTTCAAGCTAAGG + Intronic
1034164555 7:149015312-149015334 CTTCCTTTACCATCAGGCTATGG + Intronic
1039970654 8:42319056-42319078 CTAAACTTGACATCAGGCAAAGG - Intronic
1042105254 8:65319493-65319515 CTAAAAATGCCACCAGGGTATGG - Intergenic
1050878821 9:10674626-10674648 CTTCAGTTGCCCTCAGGCTCAGG + Intergenic
1055011520 9:71571475-71571497 CTCCAAATGCCATCATGCTGGGG + Intergenic
1056298094 9:85213794-85213816 CTATAATTGCCATGAGTCAAGGG - Intergenic
1058720890 9:107762587-107762609 CTCCAATTGCCAACATGCAATGG - Intergenic
1058767710 9:108198194-108198216 CAGCAATTCCCATCTGGCTAGGG - Intergenic
1059513240 9:114869268-114869290 CCACAATTCACATCTGGCTATGG + Intergenic
1061446955 9:130644348-130644370 CAACAATTTCCTTCAGGCAAAGG + Intergenic
1193344494 X:80388927-80388949 GGACAATTTCCATCTGGCTAGGG + Intronic
1196291016 X:113941184-113941206 ATAAAATTACCTTCAGGCTATGG - Intergenic
1197676291 X:129334510-129334532 CTGCAATTCCCTTCTGGCTAGGG - Intergenic
1198818177 X:140615034-140615056 CCACAATTCCCCTCTGGCTAGGG + Intergenic