ID: 1067775766 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:49163877-49163899 |
Sequence | CCCAAGCGCATGACTCCATG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1067775762_1067775766 | 22 | Left | 1067775762 | 10:49163832-49163854 | CCTCAAAAAAAGTGAACTTCTCA | No data | ||
Right | 1067775766 | 10:49163877-49163899 | CCCAAGCGCATGACTCCATGAGG | No data | ||||
1067775763_1067775766 | -8 | Left | 1067775763 | 10:49163862-49163884 | CCATGTCCAGCTCATCCCAAGCG | No data | ||
Right | 1067775766 | 10:49163877-49163899 | CCCAAGCGCATGACTCCATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1067775766 | Original CRISPR | CCCAAGCGCATGACTCCATG AGG | Intronic | ||