ID: 1067775766

View in Genome Browser
Species Human (GRCh38)
Location 10:49163877-49163899
Sequence CCCAAGCGCATGACTCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067775762_1067775766 22 Left 1067775762 10:49163832-49163854 CCTCAAAAAAAGTGAACTTCTCA No data
Right 1067775766 10:49163877-49163899 CCCAAGCGCATGACTCCATGAGG No data
1067775763_1067775766 -8 Left 1067775763 10:49163862-49163884 CCATGTCCAGCTCATCCCAAGCG No data
Right 1067775766 10:49163877-49163899 CCCAAGCGCATGACTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067775766 Original CRISPR CCCAAGCGCATGACTCCATG AGG Intronic