ID: 1067776963

View in Genome Browser
Species Human (GRCh38)
Location 10:49170902-49170924
Sequence CAGGGGACATCAGCCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 231}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067776963_1067776969 -2 Left 1067776963 10:49170902-49170924 CCAGCACTGGCTGATGTCCCCTG 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1067776969 10:49170923-49170945 TGGCTCTGCAAAGTAGCTGGAGG No data
1067776963_1067776972 16 Left 1067776963 10:49170902-49170924 CCAGCACTGGCTGATGTCCCCTG 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1067776972 10:49170941-49170963 GGAGGATGGCTGGCCCTAGCAGG No data
1067776963_1067776971 6 Left 1067776963 10:49170902-49170924 CCAGCACTGGCTGATGTCCCCTG 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1067776971 10:49170931-49170953 CAAAGTAGCTGGAGGATGGCTGG No data
1067776963_1067776970 2 Left 1067776963 10:49170902-49170924 CCAGCACTGGCTGATGTCCCCTG 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1067776970 10:49170927-49170949 TCTGCAAAGTAGCTGGAGGATGG No data
1067776963_1067776973 25 Left 1067776963 10:49170902-49170924 CCAGCACTGGCTGATGTCCCCTG 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1067776973 10:49170950-49170972 CTGGCCCTAGCAGGCCTGCTTGG No data
1067776963_1067776967 -5 Left 1067776963 10:49170902-49170924 CCAGCACTGGCTGATGTCCCCTG 0: 1
1: 0
2: 2
3: 30
4: 231
Right 1067776967 10:49170920-49170942 CCCTGGCTCTGCAAAGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067776963 Original CRISPR CAGGGGACATCAGCCAGTGC TGG (reversed) Intronic
900031115 1:373808-373830 CTGGGAACAGCAGCCAGTGGCGG - Intergenic
900051684 1:602062-602084 CTGGGAACAGCAGCCAGTGGCGG - Intergenic
900709117 1:4101322-4101344 CATTGGACATCAGGCAGTGAAGG - Intergenic
900981416 1:6048237-6048259 CAGGGGCCAGCAGGCAGGGCGGG - Intronic
901296048 1:8161669-8161691 CAGGTGACATTAGCGAGAGCAGG - Intergenic
901296050 1:8161688-8161710 CAGGTGACGTGAGCCAGAGCAGG - Intergenic
901609925 1:10489886-10489908 CATTGGACAGCAGGCAGTGCAGG - Intronic
902221476 1:14968613-14968635 CAGGGCACAGCAGCCAGCACGGG + Intronic
903353445 1:22731885-22731907 CAGGGCACAGAAGCCAGGGCCGG + Intronic
904300623 1:29551159-29551181 CAGGTGACAGCAGCGAGTGATGG + Intergenic
905099718 1:35509010-35509032 CACTGGACAACAGGCAGTGCAGG + Intronic
906014052 1:42557421-42557443 CAGTGGACATTGGCCAGTGTGGG + Intronic
907988006 1:59552132-59552154 CAGGGGACACCAGCCGATGCTGG + Intronic
910924683 1:92386262-92386284 CAGGAGACAACAGCCATTGGGGG + Intronic
913961138 1:143338906-143338928 CAGGGGCCAGCAGGCAGTGCGGG - Intergenic
914055492 1:144164479-144164501 CAGGGGCCAGCAGGCAGTGCGGG - Intergenic
914123654 1:144801883-144801905 CAGGGGCCAGCAGGCAGTGCGGG + Intergenic
914226930 1:145728341-145728363 CAGGGCACAGCAGCCTCTGCCGG - Exonic
914312060 1:146475525-146475547 CAGTGGACATCTGTCAGTGGAGG - Intergenic
914502291 1:148257810-148257832 CAGTGGACATCTGTCAGTGGAGG + Intergenic
915464639 1:156089797-156089819 CTGGGGAAATCAGACAATGCAGG - Intronic
918125814 1:181582426-181582448 CATGTGACACCAGCCACTGCAGG - Intronic
920028246 1:203017604-203017626 CACGGGATATCTGCCACTGCAGG - Intronic
920284815 1:204871785-204871807 CAGGTGACATAAGCCTGTGTGGG - Intronic
922559908 1:226561820-226561842 CAGGGAACATGAGAGAGTGCAGG + Intronic
922580976 1:226697830-226697852 GAGGGCACATCTGCCAGGGCAGG - Intronic
924179198 1:241424213-241424235 CAGGGGACTTCAGCGGGAGCCGG + Intergenic
924372340 1:243364525-243364547 GAGGTGACCTCAGCCAGAGCCGG + Intronic
1062844084 10:690856-690878 CACGGGACATTGGCCAGCGCTGG + Intergenic
1064242923 10:13646973-13646995 CACTGGACATCAGCTAGTTCTGG + Exonic
1064685007 10:17851804-17851826 CTGGAAACATCTGCCAGTGCTGG + Intronic
1065426978 10:25616011-25616033 CAGAGCACATCAGCCTGTGATGG + Intergenic
1065879458 10:30026732-30026754 CTGGGGACATCTGCCGGTGCTGG + Exonic
1067776963 10:49170902-49170924 CAGGGGACATCAGCCAGTGCTGG - Intronic
1070793409 10:79203102-79203124 CAGGGGCCAGCAGCCCATGCTGG - Intronic
1074151502 10:110763439-110763461 CAGTGGACACCAGGCATTGCAGG + Intronic
1076121541 10:127940508-127940530 CAGGGGGACTCTGCCAGTGCAGG - Intronic
1076412793 10:130263951-130263973 GAGGGGACAGCTCCCAGTGCCGG + Intergenic
1076521888 10:131086470-131086492 CAGGCGACATGAGCTAGTGCGGG - Intergenic
1076691014 10:132223930-132223952 CAGGGGACATCAGCCTGGCAGGG - Intronic
1077193947 11:1269984-1270006 CTGGGCACATCAACCAGTGCTGG - Intergenic
1079507501 11:21169877-21169899 CTGGGGACATCTGCCAGTGCTGG - Intronic
1079970689 11:27031927-27031949 CGGGCACCATCAGCCAGTGCAGG - Intergenic
1081964335 11:47160597-47160619 AAGGGGAAATCTGCCTGTGCCGG + Intronic
1083173814 11:60937354-60937376 CAGGGAACATCAACAATTGCCGG - Exonic
1083457525 11:62789027-62789049 CAGGGGACATCTACCACTGAAGG - Exonic
1083644898 11:64166355-64166377 CCGGGGGCTTCAGCCCGTGCCGG - Intergenic
1083798530 11:65032604-65032626 AAGGGGACCTCCGCCAGTGGGGG + Intronic
1084431909 11:69115910-69115932 CAGGGCACAGAGGCCAGTGCCGG - Intergenic
1084770615 11:71340668-71340690 CAGGGCACATCAGACCGTGATGG - Intergenic
1086580017 11:88388655-88388677 AAGGGCACATAAGCCAGTGTGGG - Intergenic
1088871891 11:113897422-113897444 CAGGGGAGATCCCCCAGTGCTGG + Intergenic
1089361186 11:117887724-117887746 CCAGGGACATCAGCCAGGGGTGG + Intergenic
1089938822 11:122394321-122394343 CAGGGGTCAAAAGCCAGTGAGGG - Intergenic
1092915410 12:13184763-13184785 CAGGGGAGATCAACCAGGACAGG + Intergenic
1096531227 12:52244050-52244072 CAGGGCAGCTCAGCCTGTGCAGG + Intronic
1096903834 12:54914343-54914365 CACAGGAAATCAGCCACTGCAGG - Intergenic
1103230084 12:119322294-119322316 CATTGGACATCAGCCAGTGAAGG + Intergenic
1106556740 13:30816365-30816387 AATGGGACATCAGGCACTGCTGG - Intergenic
1107099254 13:36571592-36571614 CAGGGGAAATAAGACAATGCAGG - Intergenic
1112722252 13:102258431-102258453 CAGAGGACCTCAGCCAATGGTGG - Intronic
1113345936 13:109478443-109478465 CACTGGGCATCAGCCAGTACAGG - Intergenic
1113363657 13:109655803-109655825 CAGGGGGAATTAGCCAGGGCTGG - Intergenic
1117494504 14:56289376-56289398 CAGGGGACATCTGGAAGTGCAGG - Intronic
1117787041 14:59296990-59297012 CACTGAACATCAGCCAGTGTTGG - Intronic
1119536267 14:75404959-75404981 CACAGGACATTATCCAGTGCTGG + Intergenic
1121093913 14:91202620-91202642 CAGAGGACCTCAGCCTGTGGGGG + Intronic
1121418038 14:93792744-93792766 CAGGGAACATAGGCCAGTGGTGG - Intergenic
1121645269 14:95514212-95514234 CAGGGGACTCCAGCCTGGGCGGG - Intergenic
1122147029 14:99697571-99697593 CACTGGACAACAGGCAGTGCAGG - Intronic
1122147238 14:99698885-99698907 CACTGGACAACAGGCAGTGCAGG - Intronic
1122650239 14:103221932-103221954 AAAGGGACAACAGCCAGAGCTGG - Intergenic
1122827799 14:104379652-104379674 TAGCGGACAGCAGGCAGTGCAGG + Intergenic
1122896743 14:104761430-104761452 CATCGGACAGCAGCCATTGCAGG + Intronic
1123010426 14:105347027-105347049 CAGCGGACAACAGGCAGTGGGGG - Intronic
1123412445 15:20071995-20072017 CCTGGGACATCAGCCAGGTCAGG + Intergenic
1123521787 15:21079108-21079130 CCTGGGACATCAGCCAGGTCAGG + Intergenic
1124493723 15:30173826-30173848 TGGGTGACAGCAGCCAGTGCAGG + Intergenic
1124749844 15:32364823-32364845 TGGGTGACAGCAGCCAGTGCAGG - Intergenic
1126013687 15:44329136-44329158 CTGGGAACATCTCCCAGTGCTGG - Intronic
1127565901 15:60187765-60187787 CAGGGGGCACCAGACACTGCAGG - Intergenic
1127781514 15:62320515-62320537 CAGCCGTCATCAGCCTGTGCTGG + Intergenic
1128352615 15:66901169-66901191 CAGAGGACATCTGCCAGGGCTGG - Intergenic
1129372238 15:75104799-75104821 CACTGGACAGCAGCCAATGCAGG - Intronic
1132357666 15:101184778-101184800 CAGGGGCCACCAGCCAGTCTGGG - Intronic
1132918260 16:2366829-2366851 CAGGGGACACCTGCCAGTGTGGG + Intergenic
1133940997 16:10308830-10308852 AGGGGGACACCAGCTAGTGCCGG - Intergenic
1134203764 16:12220570-12220592 CAGGGGAGATCAGCACGAGCAGG - Intronic
1138445540 16:57060970-57060992 CCAGGGAGCTCAGCCAGTGCTGG + Intronic
1139964876 16:70739703-70739725 AACGTGACCTCAGCCAGTGCTGG + Intronic
1141049999 16:80752772-80752794 CAGCTGACATCAGCCACAGCGGG - Intronic
1141157607 16:81608295-81608317 GAGGGGACTTCAGGCATTGCTGG + Intronic
1141551158 16:84807570-84807592 GACGGGACATCAGGCATTGCCGG + Intergenic
1143217316 17:5234668-5234690 CAGCAGACATCTGCCAGCGCTGG - Intronic
1144969120 17:19096127-19096149 CAGGGGCCATCAGGCTGTGAGGG - Intronic
1144978796 17:19155939-19155961 CAGGGGCCATCAGGCTGTGAGGG + Intronic
1144989426 17:19222293-19222315 CAGGGGCCATCAGGCTGTGAGGG - Intronic
1145796215 17:27656746-27656768 CAGGGGGCAGCGGCCAGTGGTGG + Intergenic
1145810664 17:27762068-27762090 CAGGGGGCAGCGGCCAGTGGTGG + Intronic
1147878590 17:43639326-43639348 CAGGGGACATCACCCTCTTCTGG - Intergenic
1151566643 17:74902267-74902289 CAGTGGGCATCAGCCAGGCCTGG - Intergenic
1152583842 17:81180476-81180498 CTGGGGGAATCAGCCACTGCAGG + Intergenic
1152681965 17:81673090-81673112 CAGTGCACATCAGGCAGAGCAGG + Exonic
1152753521 17:82077521-82077543 CAGGGGCCATCTCCCAGGGCAGG - Intergenic
1152948526 17:83211861-83211883 CTGGGAACAGCAGCCAGTGGCGG + Intergenic
1154341698 18:13508283-13508305 CAGGGTAAAGCAGCAAGTGCTGG + Intronic
1155885864 18:31207219-31207241 CAGGGAGCCTGAGCCAGTGCAGG - Intergenic
1155886172 18:31211304-31211326 CAGGGGAGATAAGCCCATGCAGG + Intergenic
1156405542 18:36779283-36779305 CAGGGCACTTCAGCAAGAGCAGG + Intronic
1156479241 18:37425918-37425940 GAGAGGACATCAGCCAGGGAGGG + Intronic
1157437947 18:47687107-47687129 CAGGCAACATCTGACAGTGCGGG - Intergenic
1157567444 18:48689138-48689160 CAGGGTACAACTGCCAGTGCGGG - Intronic
1159118030 18:64137204-64137226 CAGGGGACAGCAAGCACTGCTGG + Intergenic
1160352791 18:78199135-78199157 CAAGGGACATCAGGGGGTGCTGG - Intergenic
1160762308 19:791795-791817 CAGGGGAGTTCAGCTAGAGCTGG - Intergenic
1160892670 19:1387510-1387532 CACAGGGCAGCAGCCAGTGCGGG + Intronic
1161719204 19:5894001-5894023 CAGGGAGCATGAGCCAGTTCTGG + Intronic
1162081522 19:8220635-8220657 CAGGTGACAGCAGCCAGAGTGGG - Intronic
1162182974 19:8883262-8883284 CAGGGCCCATCAGCCAGATCAGG - Intronic
1164596403 19:29533268-29533290 CAGTGGACATCAGCCCCTCCAGG - Intronic
1164833584 19:31341437-31341459 CAGGCAACATCAGCCACTCCCGG + Intronic
1164982926 19:32627866-32627888 CAGGGGGGCTCAGCCAGCGCAGG + Intronic
1166049847 19:40252160-40252182 CAGCTGACATCAGCCTGTGTGGG + Intronic
1202694975 1_KI270712v1_random:117156-117178 CAGGGGCCAGCAGGCAGTGCGGG - Intergenic
925755912 2:7132564-7132586 CTGGAGACATTACCCAGTGCTGG + Intergenic
926030732 2:9585323-9585345 CTTTGGACATCAGACAGTGCAGG - Exonic
926252503 2:11163632-11163654 CAGGAGACAGCGGCCAGGGCTGG - Intronic
926271671 2:11371523-11371545 CAGAGGACAACAGCCAGTAAGGG - Intergenic
926395790 2:12440897-12440919 CAGGGGACAGAGGGCAGTGCTGG - Intergenic
926575217 2:14572584-14572606 TAGGATACAACAGCCAGTGCTGG - Intergenic
926880405 2:17539042-17539064 CAGGGCTCTTCCGCCAGTGCTGG - Intergenic
929086850 2:38176507-38176529 CAGGGTACCACCGCCAGTGCTGG + Intergenic
930861946 2:56083584-56083606 TAGAGGAAAACAGCCAGTGCTGG - Intergenic
932081337 2:68718322-68718344 AAGGGGCCATCAGGCAATGCTGG - Intronic
932805480 2:74779102-74779124 CAGGGGCAATCAGGCAGAGCTGG + Intergenic
934276144 2:91574204-91574226 CAGGGGCCAGCAGGCAGTGCGGG - Intergenic
934604495 2:95683431-95683453 CAGGGCACAGAAGGCAGTGCTGG + Intergenic
934963174 2:98695434-98695456 CTGTGGACATCACACAGTGCAGG + Intronic
936537898 2:113325662-113325684 CAGGGCACAGGAGGCAGTGCTGG + Intergenic
937888162 2:126914744-126914766 CAGGGCAGCTCATCCAGTGCAGG + Intergenic
937906451 2:127055070-127055092 CCGGGGCCCTCAGGCAGTGCTGG + Intronic
939561255 2:143734638-143734660 CAGGCAACATCAGCAACTGCAGG - Intronic
942606723 2:177699765-177699787 CAGGGGACTGGAGGCAGTGCTGG + Intronic
942858852 2:180585548-180585570 CAGGTGACATCAAACACTGCTGG + Intergenic
946186386 2:217983055-217983077 CTGGGAACATCAGACACTGCTGG + Intronic
946498423 2:220219474-220219496 CAGGGCACATCTGCCTGTGCTGG + Intergenic
947514454 2:230789912-230789934 CAGTGGACTTCAGGCAGTACAGG - Intronic
948462870 2:238138782-238138804 CAGGGGACAGCAGAGAGGGCAGG + Intronic
1169476176 20:5933078-5933100 CTGGGTATATGAGCCAGTGCTGG + Intergenic
1172706784 20:36887866-36887888 CAGGGGACATAACTCATTGCAGG + Intronic
1175996646 20:62814990-62815012 CTGGGGACAGCAGGCAGTGCTGG + Intergenic
1176154664 20:63612596-63612618 CAAGCGACATCACCAAGTGCTGG - Intronic
1178233338 21:30812824-30812846 CAGAGAACATCAGCCAGGGGAGG + Exonic
1179071036 21:38071242-38071264 CAGGGGACATTTGGCACTGCTGG - Intronic
1179334081 21:40433734-40433756 CAGGTGACATCATCCACTTCAGG - Intronic
1179424236 21:41260614-41260636 CAGAGGACATCAGGCAGTCCTGG - Intronic
1181169518 22:21000370-21000392 CAGGTGACATCAGCAGGTGGAGG + Exonic
1181363629 22:22357525-22357547 CAGAGGACATCAGGCAGGGCAGG - Intergenic
1181372813 22:22431732-22431754 CAGAGGACACCAGGCAGGGCAGG - Intergenic
1181475499 22:23165399-23165421 CACAGGGCATCAGCCAGTGAAGG + Intergenic
1183061094 22:35336788-35336810 CAGGGGTCACCACCCAGTGCAGG + Intronic
1183672947 22:39283617-39283639 CAGGGGGCATCAGGCAGCCCGGG - Intergenic
1184824026 22:46934865-46934887 CAGGGGCCATCAGCGTGTGGTGG + Intronic
1184883152 22:47324856-47324878 CAGTGGACAACAGCCTGTGCTGG + Intergenic
1184984359 22:48119360-48119382 CAGGGGTCATCAGTCAGTGGTGG - Intergenic
1185023860 22:48396529-48396551 CAGGGCTCAGCAGACAGTGCTGG + Intergenic
950184054 3:10934266-10934288 CAGGGGACATCAGCCTCCTCAGG - Intronic
950833010 3:15893812-15893834 GAGGGGTCACCAGCCAGGGCAGG - Intergenic
953497177 3:43397873-43397895 CAGTGGACATCAGGCAGTGAAGG - Intronic
953568385 3:44052225-44052247 GAAGGAACTTCAGCCAGTGCAGG + Intergenic
954457447 3:50607542-50607564 GAGGGGACATCAGCCCCAGCTGG - Exonic
954799743 3:53180472-53180494 CAGGGGACTTCTGCCAGCACTGG - Intronic
955003361 3:54947436-54947458 CAGCTGGCATCTGCCAGTGCAGG + Intronic
956717072 3:72088132-72088154 CAGTGCACATCAGGCAGAGCAGG + Intergenic
959649403 3:108737122-108737144 CAGGTGGCAGCAGCCAGAGCAGG + Intergenic
962306514 3:134291745-134291767 CAGGGAACATGAGCCTGTGAAGG + Intergenic
962481225 3:135800363-135800385 TAGGGCACATCAGCCCATGCAGG + Intergenic
963100639 3:141600304-141600326 CTTTGGACATCAGACAGTGCAGG - Intronic
964451834 3:156820840-156820862 CAGGGGACATCAGCCTATAGTGG - Intergenic
967144780 3:186597444-186597466 CAGAGGAGTCCAGCCAGTGCAGG + Intergenic
968910088 4:3473112-3473134 CAGGGCAAATCCGCCAGTGAAGG + Intronic
968939500 4:3630701-3630723 CAGGAGGCATCAGCCAGGGCGGG + Intergenic
968953996 4:3708949-3708971 CCAAGGACCTCAGCCAGTGCTGG + Intergenic
969092529 4:4705788-4705810 CAGGGGAAATCAGGCAGCCCAGG - Intergenic
969581543 4:8068382-8068404 CACAGGTCCTCAGCCAGTGCTGG + Intronic
970666539 4:18343147-18343169 GAGGGGGCAGCAGCCAGTACTGG - Intergenic
971372335 4:26029019-26029041 CAGGGGACCTCCGCCAGGCCAGG + Intergenic
973944521 4:55943398-55943420 CAGGGGATATCAGCTAGTATAGG - Intergenic
978656780 4:111074692-111074714 CAGGCCCCAGCAGCCAGTGCTGG - Intergenic
978866074 4:113513071-113513093 CAGTGGCCACCAGTCAGTGCTGG - Intronic
981144929 4:141313036-141313058 CATGGGACATCACCCAGGGCTGG - Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
982638980 4:157933081-157933103 CAAGGAACAACAGGCAGTGCAGG - Intergenic
982749006 4:159136880-159136902 CAGGGAACAGTAGCCAGTTCAGG - Intronic
984552496 4:181177355-181177377 CAGTGGGAATGAGCCAGTGCAGG + Intergenic
985629346 5:1006718-1006740 GAGGGCACGGCAGCCAGTGCAGG + Intergenic
989561536 5:42857702-42857724 CATAGGACATCAGACTGTGCAGG + Intronic
990446482 5:55898050-55898072 CATGGGACAACAGCCAGAGATGG + Intronic
991395645 5:66202471-66202493 CATTGGACATCAGGCAGTGCAGG - Intergenic
997674776 5:135704784-135704806 CACTGGCCATCAGCCAGTACAGG - Intergenic
997848293 5:137308152-137308174 AACTGGACTTCAGCCAGTGCAGG + Intronic
998213931 5:140223294-140223316 CAGGGGCCATGTGCCAGAGCAGG - Intronic
1001107796 5:168870245-168870267 CTGGGGGCAACAGCCAGTTCTGG - Intronic
1002742705 5:181445060-181445082 CTGGGAACAGCAGCCAGTGGCGG + Intergenic
1003392934 6:5728956-5728978 AAGAGCACACCAGCCAGTGCTGG - Intronic
1005697708 6:28366582-28366604 CAGTAGACATCACCAAGTGCTGG - Exonic
1005873487 6:29994621-29994643 GAGGGAGCATCAGCCAGGGCAGG + Intergenic
1005889736 6:30127321-30127343 CCTGGGCCAGCAGCCAGTGCCGG - Intergenic
1006037155 6:31222882-31222904 GAGGGAGCATCAGCCAGGGCAGG - Intergenic
1006075496 6:31529706-31529728 GAGGGAGCATCAGCCAGGGCAGG - Intronic
1006793816 6:36720037-36720059 CAGGGGCCAGCAGCCACTGTAGG + Intronic
1006874417 6:37282797-37282819 AAGGAGACATCAGGCAGTGCTGG + Intronic
1007375512 6:41453482-41453504 CTGGGGACAGCAGCCAGAGTTGG - Intergenic
1007842479 6:44728087-44728109 CAGGGGAAAACAGCCTGAGCAGG + Intergenic
1012477640 6:99632214-99632236 CAGTGGAAATCCGCCAGTACAGG + Intergenic
1014144496 6:117981500-117981522 GAGGTGACATCAGGGAGTGCTGG + Intronic
1015526160 6:134176496-134176518 GCGGGGACGTGAGCCAGTGCTGG + Intronic
1016600350 6:145851791-145851813 CAGTGGCTATCAGGCAGTGCAGG + Intergenic
1017529878 6:155278950-155278972 CAGGGGACATTCGGCAATGCTGG + Intronic
1019247840 6:170720799-170720821 CTGGGAACAGCAGCCAGTGGCGG + Intergenic
1019290088 7:246059-246081 CCGGGGCCCCCAGCCAGTGCAGG + Intronic
1019298095 7:289730-289752 GAGGAGACTTCCGCCAGTGCAGG + Intergenic
1019534754 7:1523207-1523229 CGGGGGACCTCTGCCTGTGCAGG - Intergenic
1019616243 7:1963921-1963943 CAGGAGGCATCAGCTGGTGCCGG - Intronic
1019644788 7:2123325-2123347 CAGGGGAGCTCAGCCAGCTCAGG + Intronic
1020757475 7:12221566-12221588 CATTGGACATCAGCCAGCACAGG + Intronic
1021206387 7:17786509-17786531 GAGGGAGCATCAGCCAGGGCAGG - Intergenic
1021929005 7:25561317-25561339 CAGGGGCCAGGAGGCAGTGCAGG - Intergenic
1023093433 7:36637475-36637497 CAGGGGACATTTGGCAATGCTGG + Intronic
1023848071 7:44134489-44134511 CAGGGGGCTTGAGCCAGAGCAGG + Intergenic
1024025540 7:45406999-45407021 CAGAGGACATCCGCCATTGGGGG + Intergenic
1024103760 7:46059815-46059837 CAGGGGCCAGCAGCCAGTGCTGG + Intergenic
1029331947 7:99864681-99864703 CAGAGGACATTATCCATTGCAGG + Intronic
1032127240 7:129203942-129203964 CAGGGGACGTGAGCTAGTTCTGG + Intronic
1034574737 7:151987294-151987316 CTGGGGACAAGAGCCAGTGACGG + Intronic
1035500277 8:87065-87087 CTGGGAACAGCAGCCAGTGGCGG - Intergenic
1035652791 8:1281514-1281536 CAGGAGACATCAGGGAGTCCAGG - Intergenic
1036054688 8:5238722-5238744 CAGGGGCCAGGAACCAGTGCTGG - Intergenic
1037260863 8:17006582-17006604 CAGGGGACATAAGCCAAATCTGG + Intergenic
1037688010 8:21159774-21159796 CATGGGGCATCACCCAGAGCAGG + Intergenic
1039685973 8:39802000-39802022 CAGGCAGCCTCAGCCAGTGCTGG + Intronic
1045623090 8:104005722-104005744 CAGGGACCCTCAGCCAGTTCTGG - Intronic
1047029700 8:120862910-120862932 CAGTAGACAACAGGCAGTGCAGG + Intergenic
1049032440 8:140047758-140047780 CATGGGACATGAGCCCGGGCTGG + Intronic
1049408081 8:142460540-142460562 CAGGGGCCATCAGCAAGTCAGGG - Intronic
1050982304 9:12035886-12035908 CAGGCAACCGCAGCCAGTGCTGG - Intergenic
1054451268 9:65404631-65404653 CAGGAGGCATCAGCCAGGGCAGG - Intergenic
1056968481 9:91183717-91183739 CAGGTGACTTCAACCAGTCCTGG - Intergenic
1057092306 9:92269465-92269487 CAGGGTACATCATCCACTGCAGG + Intronic
1059142112 9:111863560-111863582 AAGGTAACAACAGCCAGTGCTGG - Intergenic
1061637802 9:131925758-131925780 CAGGGGACAGCAGCTCCTGCGGG + Intronic
1061764764 9:132874776-132874798 CAGGCGACATCAGCTAGGGCAGG + Intronic
1062037106 9:134387211-134387233 AACGGGACATGAGCCAGGGCCGG - Intronic
1062064046 9:134516684-134516706 CAGAGGACCTCAGCTAGCGCAGG - Intergenic
1186461902 X:9754583-9754605 CAAGGGTCTTCAGCCAGTGGGGG - Intronic
1186826632 X:13346735-13346757 AGGGGGACAGCACCCAGTGCTGG + Intergenic
1188833741 X:34931972-34931994 CAGGTGTCATCTGCCAGTTCAGG - Intergenic
1189721000 X:43917533-43917555 CACTGGACATCAGGCTGTGCAGG - Intergenic
1190476263 X:50830881-50830903 GAACGGACATCAGCCAGTGTTGG - Intergenic
1193438653 X:81512206-81512228 CAGAGGACTTCAGCCAGTTGTGG - Intergenic
1193483724 X:82060027-82060049 CAGGTGTCATCTGCCATTGCAGG - Intergenic
1195060642 X:101191151-101191173 CTTTGGACATCAGACAGTGCAGG - Intergenic
1196013804 X:110916174-110916196 CAATGGACATGAGCCAGAGCCGG + Intergenic
1199899973 X:152163514-152163536 GAGCAGACATCAGCCAGTGAAGG + Intergenic