ID: 1067780461

View in Genome Browser
Species Human (GRCh38)
Location 10:49199778-49199800
Sequence CCTCATATACTGCTGGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067780456_1067780461 11 Left 1067780456 10:49199744-49199766 CCAATGGTTGGTGAAAATATCAA No data
Right 1067780461 10:49199778-49199800 CCTCATATACTGCTGGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067780461 Original CRISPR CCTCATATACTGCTGGTAGG AGG Intergenic
No off target data available for this crispr