ID: 1067781039

View in Genome Browser
Species Human (GRCh38)
Location 10:49207724-49207746
Sequence TGGCACGTCCTGCCAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067781039_1067781048 4 Left 1067781039 10:49207724-49207746 CCTGCCCCTGGCAGGACGTGCCA No data
Right 1067781048 10:49207751-49207773 ACGGGTCAGATGGCCCCAGGTGG No data
1067781039_1067781049 5 Left 1067781039 10:49207724-49207746 CCTGCCCCTGGCAGGACGTGCCA No data
Right 1067781049 10:49207752-49207774 CGGGTCAGATGGCCCCAGGTGGG No data
1067781039_1067781051 16 Left 1067781039 10:49207724-49207746 CCTGCCCCTGGCAGGACGTGCCA No data
Right 1067781051 10:49207763-49207785 GCCCCAGGTGGGGCTTTTCCAGG No data
1067781039_1067781050 6 Left 1067781039 10:49207724-49207746 CCTGCCCCTGGCAGGACGTGCCA No data
Right 1067781050 10:49207753-49207775 GGGTCAGATGGCCCCAGGTGGGG No data
1067781039_1067781047 1 Left 1067781039 10:49207724-49207746 CCTGCCCCTGGCAGGACGTGCCA No data
Right 1067781047 10:49207748-49207770 CTGACGGGTCAGATGGCCCCAGG No data
1067781039_1067781045 -6 Left 1067781039 10:49207724-49207746 CCTGCCCCTGGCAGGACGTGCCA No data
Right 1067781045 10:49207741-49207763 GTGCCATCTGACGGGTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067781039 Original CRISPR TGGCACGTCCTGCCAGGGGC AGG (reversed) Intergenic