ID: 1067781040

View in Genome Browser
Species Human (GRCh38)
Location 10:49207728-49207750
Sequence CAGATGGCACGTCCTGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067781040_1067781045 -10 Left 1067781040 10:49207728-49207750 CCCCTGGCAGGACGTGCCATCTG No data
Right 1067781045 10:49207741-49207763 GTGCCATCTGACGGGTCAGATGG No data
1067781040_1067781050 2 Left 1067781040 10:49207728-49207750 CCCCTGGCAGGACGTGCCATCTG No data
Right 1067781050 10:49207753-49207775 GGGTCAGATGGCCCCAGGTGGGG No data
1067781040_1067781049 1 Left 1067781040 10:49207728-49207750 CCCCTGGCAGGACGTGCCATCTG No data
Right 1067781049 10:49207752-49207774 CGGGTCAGATGGCCCCAGGTGGG No data
1067781040_1067781048 0 Left 1067781040 10:49207728-49207750 CCCCTGGCAGGACGTGCCATCTG No data
Right 1067781048 10:49207751-49207773 ACGGGTCAGATGGCCCCAGGTGG No data
1067781040_1067781051 12 Left 1067781040 10:49207728-49207750 CCCCTGGCAGGACGTGCCATCTG No data
Right 1067781051 10:49207763-49207785 GCCCCAGGTGGGGCTTTTCCAGG No data
1067781040_1067781047 -3 Left 1067781040 10:49207728-49207750 CCCCTGGCAGGACGTGCCATCTG No data
Right 1067781047 10:49207748-49207770 CTGACGGGTCAGATGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067781040 Original CRISPR CAGATGGCACGTCCTGCCAG GGG (reversed) Intergenic