ID: 1067781041

View in Genome Browser
Species Human (GRCh38)
Location 10:49207729-49207751
Sequence TCAGATGGCACGTCCTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067781041_1067781051 11 Left 1067781041 10:49207729-49207751 CCCTGGCAGGACGTGCCATCTGA No data
Right 1067781051 10:49207763-49207785 GCCCCAGGTGGGGCTTTTCCAGG No data
1067781041_1067781048 -1 Left 1067781041 10:49207729-49207751 CCCTGGCAGGACGTGCCATCTGA No data
Right 1067781048 10:49207751-49207773 ACGGGTCAGATGGCCCCAGGTGG No data
1067781041_1067781047 -4 Left 1067781041 10:49207729-49207751 CCCTGGCAGGACGTGCCATCTGA No data
Right 1067781047 10:49207748-49207770 CTGACGGGTCAGATGGCCCCAGG No data
1067781041_1067781049 0 Left 1067781041 10:49207729-49207751 CCCTGGCAGGACGTGCCATCTGA No data
Right 1067781049 10:49207752-49207774 CGGGTCAGATGGCCCCAGGTGGG No data
1067781041_1067781050 1 Left 1067781041 10:49207729-49207751 CCCTGGCAGGACGTGCCATCTGA No data
Right 1067781050 10:49207753-49207775 GGGTCAGATGGCCCCAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067781041 Original CRISPR TCAGATGGCACGTCCTGCCA GGG (reversed) Intergenic