ID: 1067781046

View in Genome Browser
Species Human (GRCh38)
Location 10:49207744-49207766
Sequence GGGCCATCTGACCCGTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067781046_1067781051 -4 Left 1067781046 10:49207744-49207766 CCATCTGACGGGTCAGATGGCCC No data
Right 1067781051 10:49207763-49207785 GCCCCAGGTGGGGCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067781046 Original CRISPR GGGCCATCTGACCCGTCAGA TGG (reversed) Intergenic