ID: 1067781048

View in Genome Browser
Species Human (GRCh38)
Location 10:49207751-49207773
Sequence ACGGGTCAGATGGCCCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067781041_1067781048 -1 Left 1067781041 10:49207729-49207751 CCCTGGCAGGACGTGCCATCTGA No data
Right 1067781048 10:49207751-49207773 ACGGGTCAGATGGCCCCAGGTGG No data
1067781042_1067781048 -2 Left 1067781042 10:49207730-49207752 CCTGGCAGGACGTGCCATCTGAC No data
Right 1067781048 10:49207751-49207773 ACGGGTCAGATGGCCCCAGGTGG No data
1067781039_1067781048 4 Left 1067781039 10:49207724-49207746 CCTGCCCCTGGCAGGACGTGCCA No data
Right 1067781048 10:49207751-49207773 ACGGGTCAGATGGCCCCAGGTGG No data
1067781040_1067781048 0 Left 1067781040 10:49207728-49207750 CCCCTGGCAGGACGTGCCATCTG No data
Right 1067781048 10:49207751-49207773 ACGGGTCAGATGGCCCCAGGTGG No data
1067781036_1067781048 26 Left 1067781036 10:49207702-49207724 CCAGCTCAGTCACTACTCAATGC No data
Right 1067781048 10:49207751-49207773 ACGGGTCAGATGGCCCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067781048 Original CRISPR ACGGGTCAGATGGCCCCAGG TGG Intergenic