ID: 1067781051

View in Genome Browser
Species Human (GRCh38)
Location 10:49207763-49207785
Sequence GCCCCAGGTGGGGCTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067781046_1067781051 -4 Left 1067781046 10:49207744-49207766 CCATCTGACGGGTCAGATGGCCC No data
Right 1067781051 10:49207763-49207785 GCCCCAGGTGGGGCTTTTCCAGG No data
1067781040_1067781051 12 Left 1067781040 10:49207728-49207750 CCCCTGGCAGGACGTGCCATCTG No data
Right 1067781051 10:49207763-49207785 GCCCCAGGTGGGGCTTTTCCAGG No data
1067781039_1067781051 16 Left 1067781039 10:49207724-49207746 CCTGCCCCTGGCAGGACGTGCCA No data
Right 1067781051 10:49207763-49207785 GCCCCAGGTGGGGCTTTTCCAGG No data
1067781041_1067781051 11 Left 1067781041 10:49207729-49207751 CCCTGGCAGGACGTGCCATCTGA No data
Right 1067781051 10:49207763-49207785 GCCCCAGGTGGGGCTTTTCCAGG No data
1067781042_1067781051 10 Left 1067781042 10:49207730-49207752 CCTGGCAGGACGTGCCATCTGAC No data
Right 1067781051 10:49207763-49207785 GCCCCAGGTGGGGCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067781051 Original CRISPR GCCCCAGGTGGGGCTTTTCC AGG Intergenic