ID: 1067781841

View in Genome Browser
Species Human (GRCh38)
Location 10:49213383-49213405
Sequence GTGAGCCATCTGCCCAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067781831_1067781841 30 Left 1067781831 10:49213330-49213352 CCTGGGAAATCGGAATCTGGAAT No data
Right 1067781841 10:49213383-49213405 GTGAGCCATCTGCCCAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067781841 Original CRISPR GTGAGCCATCTGCCCAAAGT TGG Intergenic
No off target data available for this crispr