ID: 1067786846

View in Genome Browser
Species Human (GRCh38)
Location 10:49256469-49256491
Sequence CAGGAGCCCCACTCCAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067786846_1067786849 -10 Left 1067786846 10:49256469-49256491 CCCCATCTGGAGTGGGGCTCCTG No data
Right 1067786849 10:49256482-49256504 GGGGCTCCTGCTTTTGCCCCAGG No data
1067786846_1067786857 27 Left 1067786846 10:49256469-49256491 CCCCATCTGGAGTGGGGCTCCTG No data
Right 1067786857 10:49256519-49256541 GGTCCCATGACCACACCCCAAGG No data
1067786846_1067786854 6 Left 1067786846 10:49256469-49256491 CCCCATCTGGAGTGGGGCTCCTG No data
Right 1067786854 10:49256498-49256520 CCCCAGGTGTCTGTGGGAGATGG No data
1067786846_1067786851 -1 Left 1067786846 10:49256469-49256491 CCCCATCTGGAGTGGGGCTCCTG No data
Right 1067786851 10:49256491-49256513 GCTTTTGCCCCAGGTGTCTGTGG No data
1067786846_1067786852 0 Left 1067786846 10:49256469-49256491 CCCCATCTGGAGTGGGGCTCCTG No data
Right 1067786852 10:49256492-49256514 CTTTTGCCCCAGGTGTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067786846 Original CRISPR CAGGAGCCCCACTCCAGATG GGG (reversed) Intergenic
No off target data available for this crispr