ID: 1067786958

View in Genome Browser
Species Human (GRCh38)
Location 10:49257292-49257314
Sequence CTACTGTTTTTAGGCAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067786956_1067786958 7 Left 1067786956 10:49257262-49257284 CCGGGCTGTTTCTAATTGGTTGC No data
Right 1067786958 10:49257292-49257314 CTACTGTTTTTAGGCAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067786958 Original CRISPR CTACTGTTTTTAGGCAAAAC TGG Intergenic
No off target data available for this crispr