ID: 1067787672

View in Genome Browser
Species Human (GRCh38)
Location 10:49262529-49262551
Sequence CAGTGAGCGGCCAAGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067787670_1067787672 -9 Left 1067787670 10:49262515-49262537 CCGGGCTGAGCTTGCAGTGAGCG No data
Right 1067787672 10:49262529-49262551 CAGTGAGCGGCCAAGCTCAGAGG No data
1067787667_1067787672 9 Left 1067787667 10:49262497-49262519 CCAAGCCACAAAGGGCAGCCGGG No data
Right 1067787672 10:49262529-49262551 CAGTGAGCGGCCAAGCTCAGAGG No data
1067787669_1067787672 4 Left 1067787669 10:49262502-49262524 CCACAAAGGGCAGCCGGGCTGAG No data
Right 1067787672 10:49262529-49262551 CAGTGAGCGGCCAAGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067787672 Original CRISPR CAGTGAGCGGCCAAGCTCAG AGG Intergenic
No off target data available for this crispr