ID: 1067789957

View in Genome Browser
Species Human (GRCh38)
Location 10:49280286-49280308
Sequence TACCTAATGCTGCCAAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067789955_1067789957 7 Left 1067789955 10:49280256-49280278 CCGTACTAGCAAGAACTGGTAAA No data
Right 1067789957 10:49280286-49280308 TACCTAATGCTGCCAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067789957 Original CRISPR TACCTAATGCTGCCAAAGAT GGG Intergenic
No off target data available for this crispr