ID: 1067791418

View in Genome Browser
Species Human (GRCh38)
Location 10:49290917-49290939
Sequence CTGTTCTTTTTAATGAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067791415_1067791418 21 Left 1067791415 10:49290873-49290895 CCTTTCTGGTGACGCCAAAGTTC No data
Right 1067791418 10:49290917-49290939 CTGTTCTTTTTAATGAGAAATGG No data
1067791414_1067791418 29 Left 1067791414 10:49290865-49290887 CCTTCTTGCCTTTCTGGTGACGC No data
Right 1067791418 10:49290917-49290939 CTGTTCTTTTTAATGAGAAATGG No data
1067791416_1067791418 7 Left 1067791416 10:49290887-49290909 CCAAAGTTCCAGACTCTTCTTAC No data
Right 1067791418 10:49290917-49290939 CTGTTCTTTTTAATGAGAAATGG No data
1067791417_1067791418 -1 Left 1067791417 10:49290895-49290917 CCAGACTCTTCTTACACATTTTC No data
Right 1067791418 10:49290917-49290939 CTGTTCTTTTTAATGAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067791418 Original CRISPR CTGTTCTTTTTAATGAGAAA TGG Intergenic
No off target data available for this crispr