ID: 1067792656

View in Genome Browser
Species Human (GRCh38)
Location 10:49299617-49299639
Sequence GGCTAAGGTTCTTGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1067792650_1067792656 -2 Left 1067792650 10:49299596-49299618 CCGGGAGCCCATTGGTGTTGGGG 0: 1
1: 0
2: 2
3: 12
4: 168
Right 1067792656 10:49299617-49299639 GGCTAAGGTTCTTGGTGTGCTGG No data
1067792654_1067792656 -10 Left 1067792654 10:49299604-49299626 CCATTGGTGTTGGGGCTAAGGTT 0: 1
1: 0
2: 1
3: 7
4: 107
Right 1067792656 10:49299617-49299639 GGCTAAGGTTCTTGGTGTGCTGG No data
1067792644_1067792656 29 Left 1067792644 10:49299565-49299587 CCAGGGTGCTGTGCAGGGTGGTA 0: 1
1: 0
2: 0
3: 19
4: 296
Right 1067792656 10:49299617-49299639 GGCTAAGGTTCTTGGTGTGCTGG No data
1067792653_1067792656 -9 Left 1067792653 10:49299603-49299625 CCCATTGGTGTTGGGGCTAAGGT No data
Right 1067792656 10:49299617-49299639 GGCTAAGGTTCTTGGTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1067792656 Original CRISPR GGCTAAGGTTCTTGGTGTGC TGG Intronic
No off target data available for this crispr